The amount of light entering the eye is determined by the size of the: O The pupil O The lens O The cornea O The fovea

Q: I need the answer as soon as possible

A: Plants work as factories for carbohydrate production. Carbon Dioxide is generated by the cells of…

Q: Rhodopsin contains: opsin and retinal vitamin A and ATP red, blue and green pigments light waves The…

A:

Q: ECOLOGY 1.studies the influence of environmental factors and social conditions on the human body, on…

A: Ecology is the analysis of the environment, and it lets us comprehend how species coexist in…

Q: Some bacteria have the ability to survive heat, lack of moisture, cold or acidic  conditions by…

A: Bacteria are prokaryotic microorganisms that is they have a simple cellular organisation with no…

Q: Name and describe ways that organisms obtain energy and carbon from theenvironment.

A: Introduction: For survival, growth, and development, all living entities require energy. The ability…

Q: Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this…

A: RNA polymerase involved in mRNA synthesis or transcription process. Through transcription…

Q: Transcription is the first step in gene expression. It involves copying a gene's DNA sequence to…

A: Rho factor works by binding to the transcript and halts transcription by actually breaking hydrogen…

Q: Explain the correlation between gas pressure and concentration in terms of respiration.

A: Respiration can be defines as the process of exchange of gases i.e., oxygen and carbon dioxide. This…

Q: How do slowly adapting versus rapidly adapting receptors differ

A: Stimulus is  something that stirs or urges to action.

Q: 1. When the fibrinolytic factors is not regulated by the inhibitors of the fibrinolysis, what will…

A: Note:- here i will answer only first three questions according to the guidelines of bartleby. Kindly…

Q: The following statements about the 'membrane attack complex' (MAC) is incorrect. Explain (i) The…

A: Introduction :- The membrane attack complex (MAC) or terminal complement complex (TCC) is a protein…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: How are Ca2+ channels involved in phototransduction? they cause neurotransmitter release even if no…

A: Introduction The sensory transduction of the visual system is called visual phototransduction. It is…

Q: Why are there so many differentchromatin remodeling complexes incells? What are their essential…

A: Chromatin remodeling is one of the most important concepts. It uses the energy from the hydrolysis…

Q: identify each pedigree a and b as autosomal recessive or autosomal dominant. Write all the genotypes…

A: A pedigree chart displays a family tree, and shows the members of the family who are affected by a…

Q: Explain delayed type hypersensitivity (DTH). How might you expect to induce it? What components of…

A: The delayed type hypersensitivity (DTH) is characterized by the T cells recruitment into tissues to…

Q: Receptor mediated endocytosis requires the presence of a) primary active transport pumps. D) carrier…

A: Introduction Endocytosis is the formation of an intracellular membrane-bounded vesicle containing…

Q: Question 1 We have received a specialized blood sera that contains antibodies. We want to test…

A: Antibodies are proteins in the form of molecules. Proteins are biomolecules made up of several…

Q: THERMAL RADIATION - HEAT LOSS OCCURS DUE TO 1. due to the evaporation of sweat from the surface of…

A: Conduction, convection, and radiation are the three methods for transferring heat. The direct…

Q: The 1918 influenza strain killed millions of people world-wide. After recovering virus from…

A: The influenza virus, which infects the respiratory tract, causes influenza. The influenza virus is…

Q: The endomembrane system is responsible for

A: Within a eukaryotic cell, the endomembrane system is made up of several membranes suspended in the…

Q: Some traits that can be counted and expressed in whole numbers, such as bristle number in…

A: Introduction Traits are features or attributes of an organism that are influenced by the environment…

Q: 1. elimination of the source of the harmful effects of 2. early diagnosis of diseases 3. preventing…

A: As it is rightly said prevention is better than cure. So there are three types of prevention…

Q: U A) Small population increases the likelihood of losing alleles B) Population size reduced to a few…

A: When a small number of individuals is separated from a larger population, the founder effect occurs,…

Q: Name the phases of the cell cycle.  b) During which phases are the chromosomes and then the…

A: Cell cycle  Cell cycle is a division of cell takes place in various steps and divide one cell into…

Q: Which of the following is NOT regulated by glucagon? Glut-4 transporters O protein kinase A O…

A: Methylation is a posttranslational alteration of proteins that modulates the function of several…

Q: The number of chromosomes present in a nerve cell of a human being.

A: The number of chromosomes in human body is 23 pairs or 46. Out of which 2 are sex chromosome and…

Q: What bond and molecule store and provide energy to perform work?

A: ATP ( Adenosine 5'- triphosphate  ) provides energy by transferring a phosphate group to another…

Q: How does the release of mast cell mediators following activation/degranulation result in…

A: Anaphylaxis: Anaphylaxis is a severe allergic reaction that can be life-threatening. It can happen…

Q: A mutant E. coli strain is found with a mutation affecting some of its tRNA(Cys). The wild type…

A: The translation is the process of analyzing the mRNA message in order to produce a protein. It is…

Q: What are the stages into which photosynthesis is divided?

A: Introduction - Photosynthesis is a cycle utilized by plants and different life forms to change over…

Q: Choose TWO of the cell structures from the list provided. Explain the general appearance of each…

A: Cell  It is the basic fundamental entity of life. Cell make all life possible except viruses.

Q: As a future veterinarian, it is necessary to give the animals or our pets multivitamins as…

A: These are some of the most common pet supplements. Only a veterinarian's recommendation should be…

Q: There are 10 E. coli cells in a test tube.  After 4 generations in exponential phase, how many E.…

A: A growing bacterial population doubles at regular intervals. Thus, the E. coli cells grows in a…

Q: Zebras and giraffes are both herbivores. The giraffe's longer neck is an advantage because it allows…

A: Introduction A herbivore is an animal that has evolved anatomically and physiologically to eat plant…

Q: Cleavage Gastrulation Neurulation Organogenesis

A:

Q: 10.In muscle function at the sarcomere level, the formation of cross-bridges is regulated by the…

A: Sarcomere is the contractile unit of muscle fibre. The region between two Z lines is called…

Q: Explain why the 16S rRNA gene sequence can reveal useful information about bacterial taxonomy that…

A: Introduction :- The majority of bacteria are not harmful. Those that are have specific virulence…

Q: The MC1R gene affects skin and hair color in humans.There are at least 13 polymorphisms of the gene…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: While surveying plants in the jungles of Borneo, you come across a flowering plant that you have…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: D Question 2 The type of protein made by a ribosome is determined by O the Keebler Elves. O introns.…

A: Proteins are made up of amino acids. Long-chain amino acids are called polypeptides.

Q: What genetic changes madeus uniquely human? What furtheraspects of our recent…

A: DNA was identified in the nucleus in the late 1860s by Friedrich Meischer, but its function was…

Q: Tell five (5) facts about respiratory system

A: The respiratory system is the organization of organs and tissues that assist you with breathing. It…

Q: pump will stop if U a) no potassium ions are available. O b) ATP is hydrolyzed. C) there are too…

A: Pumps types of transporters(active) , are transmembrane proteins that actively move ions and/or…

Q: 6. If you have the HIV virus, can you present with symptoms?

A: HIV (human immunodeficiency virus) damages CD4 cells, also known as T cells, in the immune system.…

Q: Which chordates exhibit internal fertilization? 2. Which chordates exhibit external fertilization?

A: External fertilization: it is a mode of reproduction where a male organism's sperm fertilizes a…

Q: Name the following: (i) The organization which procures and supplies blood during an emergency.

A: WHO (World Health organization) recommends all activities related to blood collection, testing,…

Q: An increase in the reabsorption of solutes will decrease water reabsorption. True False

A: ANSWER;- True

Q: According to Emery's rule slavemaking ants parasitize the nests of: other slavemaking ant species…

A: Slave-making ants are called so because they increase the workforce of their own colony by getting…

Q: Describe the steps for immunoglobulin heavy chain class switching from IgM to IgG. Are the events…

A: Immunoglobulin class switching, also known as isotype switching, isotypic commutation, or…