We have a eukaryotic full-length mRNA molecule consisting of 33 bp 5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.

First start with a pre-MRNA with four exons and three introns and diagram the splicing reactions leading to the four exons being spliced together (a) Second, show the following two alternative splicing diagrams that would produce (b) intron 2 retention, otherwise similar to part (a) (c) mutually exclusive exon (exon 1- either exon 2 or exon 3 -- exon 4) (d) exon 2 skipping, otherwise, similar to part (a). For part (d), explain how an SR protein could influence whether exon 2 is skipped. What would happen if SR binding to the exon 2 ESE was weak? Which MRNA isoform would be more abundant?

Refer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U G G G C U U U...  beginning with the start codon, which amino acids, in order, are coded for by this section of mRNA? A) Thr-Met- Gly B) Met-Gly-Phe C) Ser-Asp-Gly-Leu  .

Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’

When the ribosome "reads" the codon UAG, UGA or UAA... A) the polypeptide is released from ribosome but ribosome continues reading the mRNA B) the proper tRNA enters the ribosome C) translation begins D) polypeptide is released from the ribosome and translation ends

The following DNA sequences found on the sense strand belong to the same eukaryotic gene: Sequence 1: 5'-GATTCAATAAAGCTCAGATCGCTCACGTCGCGACTC-3' Sequence 2: 5'-TCCGAGGTCACTAGATACTCGTCGATCGTATAAATG-3' a) Which sequence is likely to be found upstream from the coding sequence? Justify your answer. b) Which sequence is likely to be found downstream from the coding sequence? Justify your answer. c) Which sequence will not be transcribed into an mRNA transcript? Justify your answer.