Which of the mechanisms efficiently and effectively organize the DNA into a usable form? Supercoiling Higher order coiling Solenoids All of the above

Which of the following DNA-synthesizing enzymes has 5’ to 3’ polymerization activity? Mark all the answers that apply.   DNA polymerase I DNA polymerase III DNA ligase Telomerase Primase

Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )

The phenomenon where double-helical DNA absorbs UV light less than does single-stranded DNA is referred to as intercalation hyperchromism hypochromism base-stacking None of the these are correct.

Which of the following has activity that is most similar to RNA Polymerase?     Helicase     DNA Polymerase     Primase     Exonuclease

True or False:If a DNA helix contains bases pairs of XY, for PCR to copy the helix one would need to add XTP in addition to the common reagents

A replication fork is shown below. The primary enzyme that catalyzes replication is DNA polymerase That enzyme also has a proof-reading mechanis The leading strand would be the [ Select ] Helicase is a(n) enzyme [ Select ] left to right double helix to the right side bottom strand top or bottom strand, since they are complementary. top strand 3'