. DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. PTGACACAGGTTTAGCCCATCGATGGG-OH
Q: Suppose that you wish to make a sample of DNA duplex highly radioactive to use as a DNA probe. You…
A: Ionizing radiation direct affects DNA structure by inducing DNA breaks, individually, DSBs.…
Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single…
A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule…
Q: ЗА. This DNA after Bsal digestion, produces a DNA fragment with sticky ends as shown in the figure…
A: Introduction :- DNA strands are digested with the help of various restriction enzymes .Bsal is an…
Q: Complementary DNA strand of 5'-ATTCGTATTCCCGCGGTGCAAC-3' OA.) 5-TAAGCATAAGGGCGCCACGTTG-3' OB.) 3-…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: Discuss the similarities and differences between RNA polymerase and DNA polymerase
A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. Nucleotides are the…
Q: The palm domain of a DNA polymerase O contains the catalytic site of the enzyme Ograbs the incoming…
A: The majority of organisms' genetic material, deoxy ribonucleic acid (DNA), contains nucleotide…
Q: Proof-reading during DNA replication refers to: * O removal of thymine dimers by by excision repair…
A: DNA polymerases are the enzymes that build DNA in cells. During DNA replication (copying), most DNA…
Q: DNA replication AND repair both finish with the action of Primase DNA polymerase l DNA polymerase II…
A: Primase- Primase is an enzyme that produces primers, which are short RNA sequences. Primase works by…
Q: The proofreading function of DNA polymerase involves the recognitionof a ________ and the removal of…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: Some of our DNA polymerases have a proofreading function. What is meant by this and how common is…
A: The classical deoxyribonucleic acid polymerases serve to duplicate all the deoxyribonucleic acid in…
Q: /hich of the following statemer ue about DNA polymerase: DNA polymerase can synthesiz- MRNA in the…
A: DNA polymerase (DNAP) is an enzyme that makes new copies of DNA in the form of nucleic acid…
Q: DNA polymerases ___. catalyze carbon bonding seal gaps in the sugar-phosphate backbone add new…
A: DNA STRUCTURE:- DNA structure is given by Watson and Crick, who proposed the double-helical…
Q: 1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger…
A: Since there are multiple questions in this particular question, I'll answer the first one for you.…
Q: DNA polymerase is the enzyme that synthesizes new DNA during DNA replication. DNA polymerase…
A: DNA polymerase is an enzyme that is responsible for DNA synthesis.
Q: Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However,…
A: Nucleotides are the molecules composed of a sugar moiety, phosphate group, and a nitrogenous base.…
Q: DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. You
A: The DNA has been unraveled and unzipped. The helical structure has been unraveled. Special chemicals…
Q: Describe the Okazaki fragment and its formation in one of the strands of DNA essentiality of their…
A: Only while each strand of DNA is separated from an additional can DNA polymerase activity continue…
Q: How would nucleotide excision repair be affected if one of the followingproteins was missing?…
A: The process of identification and correction of damaged DNA molecule by a cell which encodes its…
Q: Which of the following correctly describes a difference between RNA & DNA polymerases? RNA…
A: Transcription is the biological process of copying a segment of DNA into RNA, for example mRNA that…
Q: Below are two sequences of a segment of DNA. Normal sequence TAG GTC CÁC Mutated sequence TAG GTC…
A: TRANSVERSION In this mutation involving a transversion i.e. a purine is substituted for a pyrimidine…
Q: Describe the genetic roles of DNA helicase and DNA polymerase. Contrast the function of DNA…
A: Helicases are enzymes that bind to nucleic acid or nucleic acid protein complexes and can even…
Q: Why are Okazaki fragments formed? A. Okazaki fragments are the result of discontinuous replication…
A: Answer : Option "E" is correct - Okazaki fragments are formed when the 5'-3' complementary strand…
Q: a) "Out of three E.coli DNA polymerases, DNA polymerases 3 has a high processivity and rate of…
A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…
Q: DNA replication Transcription Polymerase moves along DNA template from 5' to 3' or 3' to 5? What is…
A: Central dogma, is a process by which genetic information is being transferred from DNA to protein…
Q: From standpoint of replication and transcription, explain how RNA polymerase is allowed to…
A: DNA is a double standard molecule. RNA is a single standard molecule. RNA is formed from DNA…
Q: he 3'____> 5' exonuclease activity of E. coli DNA polymerase III aacounts for the ____________ of…
A: This is the enzyme complex that is primarily involved in DNA replication with the aid of four other…
Q: Explain the molecular mechanism of DNA polymerization by DNA polymerase and explain why DNA…
A: DNA replication is necessary to ensure genetic continuity and genome inheritance from parents to…
Q: 90. The DNA template fragment shown was sequenced by the Sanger method. A sample of the DNA was…
A:
Q: The epsilon subunit of DNA polymerase III is responsible for its _______ activity. A-5'---->3'…
A: DNA Polymerase III is an enzyme that is involved in DNA replication and synthesis. It has 3'-5'…
Q: explain why it is far less important for Primase to have proofreading activity than it is for DNA…
A: DNA proofreading is error correction process, in which DNA polymerase checks the each nucleotide…
Q: An investigator obtalns a bacterial temperature-sensitive mutation that affects a step in the…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…
Q: The proofreading function of DNA polymerase involves therecognition of a ________ and the removal of…
A: The process proof reading involves the removal of a newly added incorrect nucleotide. DNA polymerase…
Q: i the polymerase chain reaction, the DNA denaturation step requires a emperature in the range of ?°…
A: SOL1 In humans, fertilization is the fusion of a human egg or female gamete and sperm or male gamete…
Q: Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer…
A: DNA is the genetic material of almost all the organisms, except few viruses and is present in the…
Q: DNA polymerases cannot initiate DNA synthesis without a primer, a section of nucleic acid having a…
A: Primase is an RNA polymerase which produce short strand of primer required by DNA polymerase in DNA…
Q: Which repair process(es) use(s) a DNA polymerase? Select all that apply. base excision repair…
A: DNA polymerases are the enzyme required for the synthesis and replication of DNA. There are…
Q: "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?
A: Introduction The cDNA library is a collection of mRNA segments cloned into independent vector…
Q: (What kind of Genetic Engineering Process (GEP) # 2: process?) Picture A (Sequence #- Picture B…
A: Genetic engineering is a highly debated topic across the world right now as countries are split for…
Q: Explain the concept & importance of DNA polymerase III ?
A: The hereditary material of an organism is the gene. Genes are present in the DNA of an organism. The…
Q: Select the statement(s) that accurately describe the function of DNA polymerase and the types of…
A: Mutation is a phenomenon that results in alteration of DNA sequences. This results in changes in the…
Q: The function of gamma (y) complex of DNA polymerase III is to Select one: O a. to unwind double…
A: DNA polymerase III falls in the category of an holoenzyme that has two core enzymes, a sliding clamp…
Q: Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in…
A: Inversions are half-circle rotations of a region of a single chromosome. It is important to remember…
Q: Arrange the steps in the base excision repair process. Write the capital letter corresponding each…
A: Base excision repair Base excision repair is a DNA repairment mechanism in which the incorrect…
Q: DNA polymerase III has Options O 5 to 3' polymerase activity O 3'-5' exonuclease activity OBoth A…
A: The polymerase enzyme helps in building lengthy polymer or nucleic acid chains.
Q: describe the normal role of the component, and choose from the selection the most direct effect of…
A: Introduction :- DNA is synthesized through the process of DNA replication, during the S phase of…
Q: DNA polymerases cannot act as primers for replication, yet primase and other RNA polymerases can.…
A: DNA polymerases are the enzymes that catalyze the formation polynucleotide chains by the addition of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OHFrom standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.Formation ofa recombinant DNA molecule. GAATTC GAATTC CITAAG CITAAG double-stranded DNA DAATTO DAATTO CTTAA OG CTAA AATT GI AATT CTTAA GAARIC CTTAAG The enzyme that cataly zes the joining of fragments to form recombin ant DNA is: DNA polymerase DNA ligase helicase re striction endonuclease
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA, polymer, -ase) makes sense.COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
- Proof-reading during DNA replication refers to: * O removal of thymine dimers by by excision repair O none of the above checking for correct base pairing by DNA polymerase removal of the RNA primer before connecting Okazaki fragments O pairing of A with T and G with C by DNA polymeraseDNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
- vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNADescribe the genetic roles of DNA helicase and DNA polymerase. Contrast the function of DNA polymerase with thatof RNA polymerase.Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
