Describe how proteins are sequenced, and explain why sequence determination is important

describe insertion sequences

Explain the reasoning establishing that a sequence of three nucleotides (a triplet codon) is the basic unit of the code relating DNA to protein?

State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included)                +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA

Discuss the concept and consequences of built-in redundancy as it applies to amino acid sequences. Include an example.

The goal of structural proteomics project isa) To crystallize and determine the structure of as many proteins as possible, in many cases with little or no existing information about protein functionb) To identify and sequence of all the genes present in the human bodyc) To introduce new genes to human beingsd) To remove disease causing genes from humans

Describe how protein are created in translation. Step by step

We have talked about several examples of cis-acting elements that have dyad symmetry (inverted repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give one example of one that functions at the DNA level and briefly explain why the sequence requires dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of the element. Edit View Incort Format Tools Tablo

Compare miRNAs and siRNAs, including their functions.

Identify the features of tRNA that are important in decoding genetic information and converting it into “protein language.”