
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question

Transcribed Image Text:Protein structure and function:
a) Name two common post-translational modifications of proteins in the cell that will affect their
structure/function.
b) What are prions? Briefly describe their structure and function.
C) Explain the principles of protein folding and significance of urea and Bmercaptoethanol in the
experimental procedures addressing this question.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Similar questions
- 1. What does it mean when we say the genetic code is redundant? a) A single codon can specify the incorporation of more than one amino acid. b) The genetic code is universal (the same for all organisms). c) The genetic code is different for different organisms. d) More than one codon can specify the incorporation of the same amino acid.arrow_forwardQ9arrow_forwardthe chemical group responsible for nucleophilic attack in translational elongation is a) free alpha-NH2 group on amino acid of A site aminocyal tRNA b) the 3=hydroxyl on the 3' end ribose c) the oxygen on the alpha phosphate of the incoming NTP d) the 5= hydroxyl on the 5' end deoxyribose e) an oxyanion on the Y-phosphate of the dNTParrow_forward
- 8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5" A.) What is the MRNA sequence that would result from transcription of this sequence? Assume that the DNA would be read from left to right. What is the amino acid sequence that would result from translation of B.) the MRNA resulting from the sequence? See Codon Table on next page. 20 C.) What is the anti-codon found on the tRNA that would deliver the amino acid for the first codon in the MRNA sequence? D.) If the fourth nucleotide in the DNA sequence were deleted due to a mutation during DNA replication, what would the resulting amino acid sequence be? What type of mutation is this? E.) What impact would the mutation in the DNA sequence in PART D have on the function of the protein produced from original sequence? Why?arrow_forwardWVA1 is a protein that is secreted by epithelial tissues of mice. Which of the following is not predicted to be found in the DNA sequence of the gene that codes for WVA1? a) A DNA sequence corresponding to an exon. Ob) 5'-AATAAA-3! c) 5'-UUGACA-3'. d) A DNA sequence corresponding to a signal peptide of the amino acids chain. e) A DNA sequence corresponding to the 5'-UTR of the mRNA.arrow_forwardCystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forward
- 8arrow_forwardIn a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give rise to an mRNA for protein A and the other DNA strand is transcribed to give rise to an mRNA for protein B. a) Would there be any problem in expressing the two genes? 2. b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?arrow_forwardThe activity provides you with a version of the NGF pathway, an example of a RTK. All of the proteins involved can be in ON/OFF states. Using this cell signaling pathway you will be asked a variety of questions to determine how the molecules are regulated, but also how a cell would respond if this cell signaling party steps were interrupted or activated. Neural Growth Factir (NGF) Ras- Ras- GDP GTP Trk-A Ras-GEF braf braf МЕК МЕК ERK ERK ERK ERK STAT STAT Spiouty DNA Nucleus Cytosolarrow_forward
- Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?arrow_forward#17 #18 please I will give you ?arrow_forwardTrue or False. 1. a.) RNA polymerase decodes mRNA so the ribosome can make proteins. b.) Only coding RNA can interact with the ribosome. c.) The ribosome is composed of both protein and ncRNA. d.)The ncRNA components of the ribosome behave as a ribozyme. Pick one of the FALSE statements from the 4 previous questions and explain why it is incorrect.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)Anatomy and PhysiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONAnatomy & PhysiologyAnatomy and PhysiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,Human AnatomyAnatomy and PhysiologyISBN:9780135168059Author:Marieb, Elaine Nicpon, Brady, Patricia, Mallatt, JonPublisher:Pearson Education, Inc.,
- Anatomy & Physiology: An Integrative ApproachAnatomy and PhysiologyISBN:9780078024283Author:Michael McKinley Dr., Valerie O'Loughlin, Theresa BidlePublisher:McGraw-Hill EducationHuman Anatomy & Physiology (Marieb, Human Anatomy...Anatomy and PhysiologyISBN:9780321927040Author:Elaine N. Marieb, Katja HoehnPublisher:PEARSON

Human Anatomy & Physiology (11th Edition)
Anatomy and Physiology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Anatomy & Physiology
Anatomy and Physiology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Human Anatomy
Anatomy and Physiology
ISBN:9780135168059
Author:Marieb, Elaine Nicpon, Brady, Patricia, Mallatt, Jon
Publisher:Pearson Education, Inc.,

Anatomy & Physiology: An Integrative Approach
Anatomy and Physiology
ISBN:9780078024283
Author:Michael McKinley Dr., Valerie O'Loughlin, Theresa Bidle
Publisher:McGraw-Hill Education

Human Anatomy & Physiology (Marieb, Human Anatomy...
Anatomy and Physiology
ISBN:9780321927040
Author:Elaine N. Marieb, Katja Hoehn
Publisher:PEARSON