the chemical group responsible for nucleophilic attack in translational elongation is  a) free alpha-NH2 group on amino acid of A site aminocyal tRNA b) the 3=hydroxyl on the 3' end ribose c) the oxygen on the alpha phosphate of the incoming NTP d) the 5= hydroxyl on the 5' end deoxyribose e) an oxyanion on the Y-phosphate of the dNTP

Q: 9. Which of the following two enzymes is secreted from E. coli cells into the surrounding…

A: Enzyme is secreted from E coli cells into the surround environments is :- Beta-lactamases ar…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: You want to mutate a Trp residue which is located in the interior of a protein structure. Which of…

A: Amino acids are the monomers that are bonded by peptide bonds to make polypeptide chains.

Q: 1.The -glycosidic bond in uridine phosphate exist between a) C1 of ribose and N9 of uracil b) C3 of…

A: 1. The glycosidic linkage involves c-1 of sugar and the hydrogen atom of N-1 in uracil 2 Promoters…

Q: Choose the answer that has these events of the elongation phase of translation in the proper…

A: Translation refers to the production of proteins using mRNA and ribosomal machinery. The ribosome…

Q: which of the following process do not contribute to purine nucleotide biosynthesis? a) synthesis…

A: Biosynthesis of nucleotides occur in two ways - de novo pathway and salvage pathway. In the de novo…

Q: TRUE OR FALSE a) The electron rich nature and aromaticity of the nucleobases mediates their…

A: Nucleobases are also known as nitrogeneous bases which are  nitrogen-containing biological compounds…

Q: The piece of RNA below includes the region that codes for the binding site for the initiator tRNA…

A: Translation is a fundamental process in molecular biology that converts the genetic information…

Q: Yeast have 8 similar tRNA genes with the anticodon 5'-GUA. A researcher mutates one of these genes…

A: Original Codon Decoded: The complementary codon to the anticodon was first decoded by the tRNA…

Q: What signal does the chaperone-mediated autophagy pathway of protein degradation use to identify…

A: A cellular mechanism called chaperone-mediated autophagy (CMA) is involved in the destruction of…

Q: Christian Anfinsen showed that the enzyme Ribonuclease (RNase) is completely inactivated at high…

A: In the 1950s, Christian Anfinsen performed a series of studies. He discovered that all the…

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)? Question 36…

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: what is post-translational protein covalent modification? give three examples and name the enzyme…

A: Protein post-translational modifications (PMTs) increase the functional diversity of the proteome by…

Q: Which of the following is the correct tRNA anticodon for the Methionine codon (5'-AUG-3'). Hint:…

A: t RNA is the transfer RNA. The main function of transfer RNA is to carry amino acid on its amino…

Q: For each of the following sequences determine if they will most likely form an amphipathic α helix,…

A: Proteins are polymers of amino acids. The sequence of amino acids is governed by the sequences of…

Q: amino acids are covalently linked to tRNAs via what  a) phosphodiester bond  b) premature…

A: Protein synthesis is governed by the genes which are present on the chromosomes. The genes are first…

Q: Which of the following amino acid types is mostly likely to be hydroxylated in a posttranslation…

A: Hydroxylation is defined as a process of oxidation reaction where the carbon-hydrogen bond in the…

Q: How and when does formylmethionine become attached to the initiator tRNA in bacteria?

A: Bacterial cell is composed of three types of RNA: first type is mRNA, which codes for amino acid to…

Q: Which ribosomal subunit has the catalytic function for polypeptide biosynthesis? O a) the mRNA Ob)…

A: The larger ribosomal subunit, also known as the 50S (or 60S in eukaryotes) subunit, is liable for…

Q: This problem concerns a "typical" tyrosine residue found on the surface of a globular protein. a) If…

A: Tyrosine (Tyr or Y) is an aromatic amino acid that can be naturally produced by the body using…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Explain the function of the Shine-Dalgarno sequence in prokaryotic protein translation. Where is it…

A: The process by which prokaryotic cells, such as bacteria, synthesise proteins based on genetic…

Q: How the mutations change chemical nature of R group of amino acids? (like polar nonpolar/ charged…

A: Proteins are made of the basic subunits called amino acids. They are involved in different…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: During translation elongation, in which site do new tRNAs enter?   a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’…

A: The question addresses potential mutations in the nucleotide sequence representing the COVID-19…

Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…

A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…

Q: Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the…

A: The protein is synthesized by the process of translation. It takes place in the cytoplasm of the…

Q: The following enzyme has an exact integer number of turns. What is the length and amount of amino…

A: Enzyme are usually composed of proteins while some enzymes are ribozymes (RNA enzymes). Proteins are…

Q: Which of the following would base pair with an aminoacyl tRNA? Question 33 options: A) 5'-UGA-3'…

A: Aminoacyl-tRNA is tRNA to which it's cognate amino acid is chemically bound. The Aminoacyl-tRNA…

Q: Which of the following sequences would NOT be found as an anticodon in a tRNA? Question 35 options:…

A: The translation process that takes place in living cells helps the production of proteins from the…

Q: A heptapeptide was found to have an amino acid composition of Asp, Leu, Lys, 2 Met, Phe and Tyr. (a)…

A: Proteins are important biomolecules in that it plays an important role in many biological functions.…

Q: E. coli ribonuclease H1 is an enzyme that catalyzes the hydrolysis of phosphodiester bonds in RNA.…

A: Carboxylate relay One of the carboxylates ( Asp70) activates water molecule to release the hydroxyl…

Q: A random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a…

A: Amino acids are coded by a tripeptide sequence called codons. The first two positions of the codon…

Q: Explain how a peptide bond is formed in translation elongation in terms of: a) Which enzyme…

A: Introduction  Peptide bonds are covalent bonds that link two amino acids together to form a peptide…

Q: double-stranded helix

A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…

Q: The characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the…

A: Introduction Transcription takes place in the nucleus, During transcription, It uses DNA as a…

Q: What is an anticodon and where is it located on the tRNA structure?

A: The anticodon is a distinctive three-nucleotide sequence present on transfer RNA (t RNA) molecules.…

Q: 1. A) Explain this statement, “Most enzymes are gene-encoded proteins, but most enzymes are not only…

A: Enzymes are the catalysts, which are composed of proteins. They help in enzyme catalysis, in which…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…