Insulin is a peptide hormone encoded by the INS gene, which is on chromosome 11. Insulin is produced by pancreatic beta cells. A) Both the INS gene and insulin are examples of biological molecules that are polymers. What are the monomers and what is the polymer that make up the INS gene? What is the name of the monomers and polymer that make up insulin? B). How many copies of the INS gene are found in pancreatic beta cells? How many copies are found in other cell types, for example, cardiac muscle cells? C). Is mRNA for insulin produced in equal amounts in pancreatic beta cells and cardiac muscle cells? Why or why not? D) Diabetes mellitus can be caused by a dominant mutation in the INS gene, INS*C96Y. A healthy mother has an affect child. Give the genotype of the child at the INS locus, indicating the paternally and maternally inherited alleles.

Insulin is a peptide hormone encoded by the INS gene, which is on chromosome 11. Insulin is produced by pancreatic beta cells. A) Both the INS gene and insulin are examples of biological molecules that are polymers. What are the monomers and what is the polymer that make up the INS gene? What is the name of the monomers and polymer that make up insulin? B). How many copies of the INS gene are found in pancreatic beta cells? How many copies are found in other cell types, for example, cardiac muscle cells? C). Is mRNA for insulin produced in equal amounts in pancreatic beta cells and cardiac muscle cells? Why or why not? D) Diabetes mellitus can be caused by a dominant mutation in the INS gene, INS*C96Y. A healthy mother has an affect child. Give the genotype of the child at the INS locus, indicating the paternally and maternally inherited alleles.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

2. Peter is diabetic. So the molecular biologist cloned a DNA sequence in Peter's body cells that will synthesize insulin hormone. 5' AGCTAGACGCATCCTAATG-GCC-ACT-GAA-TCC-TGAATGGACGA 3' a) What will be the RNA of this insulin gene Sequence? b) How many amino acids will be translated from this mRNA? c) Give the amino-acid sequence of insulin.
Each type of molecule listed below is recognized by a specific class of nuclear import receptor (importin) or nuclear export receptor (exportin). For each type of molecule, state whether you think it is recognized by an importin or exportin and explain why (in terms of where that molecule is synthesized, what that molecule does, and where it does it). (a) RNA polyermase II: (b) ribosomal protein: (iii) †RNA:
Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
WVA1 is a protein that is secreted by epithelial tissues of mice. Which of the following is not predicted to be found in the DNA sequence of the gene that codes for WVA1? a) A DNA sequence corresponding to an exon. Ob) 5'-AATAAA-3! c) 5'-UUGACA-3'. d) A DNA sequence corresponding to a signal peptide of the amino acids chain. e) A DNA sequence corresponding to the 5'-UTR of the mRNA.
Answer the following questions: 1. Which of the following enzymes can polymerize deoxyribonucleotides into DNA? A) Primase B) DNA Ligase C) DNA Gyrase D) RNA Polymerase III E) Reverse Transcriptase 2. Which of the following has only one equivalent codon? A) Ala B) Arg C) Val D) Trp E) Gly 3. Which of the following does not describe transcription? A) Synthesis of RNA using DNA as the template B) Requires DNA-dependent RNA Pol C) Highly selective process that is strictly regulated D) A step in gene expression E) None of the above 4. Peptide bond formation happens in _____ site. A) A B) P C) E D) L E) B
A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the same conditions. The normal and mutantpolypeptide differ by one amino acid. The fingerprints of the peptides obtained from the two polypeptides are shown below. What kind of amino acid substitution occurred as a result of the mutation? (That is, is the substituted amino acid more or less polar than the original amino acid? Is its pI lower or higher?) (Hint: Photocopy the fingerprints, cut them out, and overlay them.)
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
Given the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'
How does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.
1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also charged methionine tRNAs with alanine? b)What would happen if an individual was homozygous for mutant alleles of the gene encoding the aminoacyl tRNA synthetase responsible for charging leucine tRNAs?