PEP ADP Pyruvate. + ATP Pyruvate Pi PEP+. H2O AG 14.8 Kcal/mol ATP. + H2O-> ADP. + Pi. AG 7 Kcal/mol
Q: Q3. Which of the following molecules best fits the following NMR spectrum? C5H8O OCH3 ppm OCH 3 O.
A: Step 1: Step 2: Step 3: Step 4:
Q: Choose the correct product for the following Diels-Alder reaction. OEt OEt product OEt OEt OEt OEt…
A:
Q: (b) ☐ The exergonic reactions catalyzed by isocitrate dehydrogenase (ICDH) and α- ketoglutarate…
A: Isocitrate Dehydrogenase (ICDH): Function: ICDH plays a crucial role in the TCA cycle by catalyzing…
Q: How will the information required to describe your RFP be obtained? Which kinds of methods are you…
A: Step 1: Document Analysis:The lab introduction provided is a crucial source of information. By…
Q: Asp48 E(-1) D(-2) H (c) ( To identify the critical enzyme resi- due:substrate interaction and…
A: The parameter is used to define catalytic efficiency of an enzyme. The greater the value, greater…
Q: 5. Trehalose, a disaccharide produced in fungi, has the following structure: CH₂OH H OH H H H H OH H…
A: a. α-D-glucopyranosyl-(1→1)-α-D-glucopyranoside b. Trehalose is not a reducing sugar.Explanation:…
Q: Model 2: Reactions of carboxylic acids and esters (3) (4) + H₂O OH (5) OH (6) 'OR' OR' + H3O® + NaOH…
A: Answer (5) Reaction number 4 in model 2 is acid base reaction Explanation:Step 1: Step 2:Step 3:…
Q: Take a look at the following molecule, and then answer the questions in the table below it. (You can…
A: Here's a breakdown of the chemical structure you showed me as to why it is a fatty acid:The molecule…
Q: Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts…
A: The objective of the question is to identify an amino acid that could replace the Serine (Ser)…
Q: NO AI GENERATED RESPONSE I NEED EXPERTS!! using results for experiment below conduct 1 graph of the…
A: The objective of the question is to create a graph that represents the rate of enzyme activity…
Q: What is the major organic product obtained from the following reaction? NaOH, H,O Δ ཨི ཁ (O) 2 ས ()…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: A particular enzyme has a ΔΔG‡ of -22.1 kJ mol-1 at 37.0 °C. Calculate the rate enhancement of this…
A: where:- k is the rate constant,- k_B is the Boltzmann constant,- T is the temperature in Kelvin,- h…
Q: MAKE A GRAPH FOR ME ON GRAPH PAPER CALL IT ENZYMES VS RATE OF REACTION USING TABLE BELOW GRAPH RUES…
A: Data Points and PlottingThe graph I created is a scatter plot that displays values from two…
Q: Rank the following three compounds in order of decreasing basicity. NH2 NH₂ NH2 NO2 I II III A) II >…
A:
Q: e model I was given is picene and I need to answer this question:
A:
Q: 4. (4 pts) a) Describe one way in which Rubisco could be improved to optimize photosynthetic…
A: Rubisco, or Ribulose-1,5-bisphosphate carboxylase/oxygenase, is the most abundant protein in the…
Q: Calculate the free energy difference at 25 °C due to a galactose gradient across a membrane from…
A: The objective of this question is to calculate the free energy difference due to a galactose…
Q: When grown anaerobically on glucose, yeast (S. cerevisiae) converts pyruvate to acetaldehyde, then…
A: Step 1: When grown anaerobically on glucose, yeast (S. cerevisiae) converts pyruvate to…
Q: Which type of inhibitor causes an apparent increase in Vmax? Question 2 options:…
A: The question is asking about the type of inhibitor that causes an apparent increase in the maximum…
Q: For the following results of Thermodynamics of Borax Solubility, the volume of Borax solution…
A: Temp oCTemp KVolume Borax, mLVolume HCl, mLTotal Volume,…
Q: A = double cutter (1000 bp, 800 bp) - 800 is being cut by the single cutter because 600 + 200 = 800,…
A: To identify which enzyme is the single cutter and which is the double cutter based on the…
Q: Which of the following could act as one of the substrates in a reaction catalyzed by a…
A: Let's break it down in detail:Glycosyltransferases are enzymes responsible for catalyzing the…
Q: phosphofructokinase reaction of Fructose-2,6-bisphosphate is a regulator of both glycolysis and…
A: Activates glycolysis and inhibits gluconeogenesis:Increased levels of…
Q: Consider the following two peptides: I. N-Pro-Pro - Glu - Glu - Tyr - His - Cys - Ala - Glu - Gln -…
A: Peptide I is more likely to form an alpha helix in aqueous solution at pH 7.0 compared to peptide II…
Q: A genetic variant is associated with low penetrance but high expressivity. This means the variant is…
A: High chance of showing disease symptoms but symptoms will be mild: This option is incorrect Low…
Q: Session 21180406 matching question Identify the type of lipid based on the structural features. 1st…
A: Lipids are a chemically diverse group of biomolecules that have two things in common:low solubility…
Q: Please help me fill out the boxes in the worksheet
A: The image represents a simplified overview of several interconnected metabolic pathways, including…
Q: Q2. Which of the following molecules best fits the following NMR spectrum? C9H12 4 ppm
A:
Q: You need to make a protein buffer of: 100 mM NaCl ⚫ 25 mM Tris 8 • • 5% w/v glycerol 2 mM DTT Your…
A: In order to calculate how much of each component we should use to get the required buffer, we need…
Q: When the amino acid sequence information and structure of a protein whose activity is unknown are…
A: Yes, inferring the activity of a protein based on its amino acid sequence and structure is a common…
Q: Which of the following amino acids have a role in the urea cycle (check all that apply)?…
A: The objective of the question is to identify the amino acids that play a role in the urea cycle. The…
Q: Hyperacetylation of histone tails is often associated with: Question 22 options:…
A: Loose conformation of Chromatin Explanation:Histone connections with DNA become weaker by…
Q: Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand…
A: Approach to solving the question: yield of ATP during cellular respirationOne glucose molecule used…
Q: The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’…
A: Start and Stop Codons:In the genetic code, certain codons have specific roles. The codon "AUG"…
Q: Under anerobic conditions how many ATP molecules will be produced when 3.5 moles of Glucose are…
A: Glycolysis:In anaerobic conditions, glycolysis is the primary pathway for glucose breakdown.During…
Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…
A: Approach to solving the question: (a) To trace the course of [1,6-(C-14)-2,5-(C-13)]glucose through…
Q: The structural classification of proteins (based on motifs) is based primarily on their O amino acid…
A: Step 1: Step 2: Step 3: Step 4:
Q: While fatty acids longer than 20 carbons are rarely found in foods, lignoceric acid (24:0) is found…
A: Liganoceric acid (24:0) metabolism entails a number of crucial processes that lead to the production…
Q: Assume the helium-neon lasers commonly used in student physics laboratories have power outputs of…
A: Please see the attached images for the solution. If there are queries or if the images are not…
Q: No need to upload any image just give me the answer with proper explanation.
A: The structure shown in the image is of a molecule that appears to be a synthetic opioid. Based on…
Q: QUESTION 5 Carbohydrates supply which element for the construction of other biomolecules? carbon…
A: Carbohydrates supply the element carbon for the construction of other biomolecules. Carbon is a…
Q: p53 is an activator of a miRNA called miR-145. miR-145 targets c-myc, a gene that promotes cellular…
A: Increased proliferation and survival.Explanation:Increased proliferation and survival would be the…
Q: What is the final reaction in the final round of fatty acid synthase? Acetyl-CoA ACP Transacylase…
A: The question is asking about the final reaction in the process of fatty acid synthesis. Fatty acid…
Q: With the advent of photosynthesis, the amount of oxygen in the atmosphere has varied over the eons…
A: Approach to solving the question:Detailed explanation:Examples:ANSWER IS 12 ML H20 Key references:…
Q: A common technique used to identify the genetic variants within a population that cause adverse drug…
A: SNP arrays (Single Nucleotide Polymorphism Arrays) are commonly used to detect single nucleotide…
Q: what are three main categories of membrane proteins, and how are they distinguished experimentally?
A: The objective of this question is to identify the three main categories of membrane proteins and…
Q: 12. What is the major organic product obtained from the following reaction? OCH 3 Br2 CH3CO₂H Br 1 2…
A: This is reaction undergo electrophilic aromatic substitution. Electrophilic aromatic substitution is…
Q: Draw the major organic product of the following reaction. H CH3CHI (excess) Draw the structure of…
A:
Q: 5. Draw head group structures and name the following glycerophospholipid. a: Glycerophospholipid…
A: ### a: Glycerophospholipid that carries a net positive charge at pH 2.5.At a low pH such as 2.5, we…
Q: 2. The diagram to the right shows the change in the structure of the C-terminal portion of each of…
A: Therefore, the final answer is: (a) Without the His146 residue, CPA-treated hemoglobin would have a…
Calculate the free E of the following reaction using the information provided inside the box. Predict if the reaction is spontaneous or not?
Step by step
Solved in 2 steps
- Effects of Changing Metabolite Concentrations on Glycolysis In an erythrocyte undergoing glycolysis what would be the effect of a sudden increase in the concentration of a. AΤP? b. AMP? c. fructose-1.6-bisphosphate? d. fructose-2, 6-bisphosphate? e. citrate? f. glucose-6-phospthate?Energetics of the Hexokinase Reaction The standard-state free energy change. Gfor the hexokinase reaction, is — 1 6.7 kJ/mol. Use the values in Table I to calculate the value of Gfor this reaction in the erythrocyte at 37°C.AG" = -69.5 kJ · mol- The percent efficiency of oxidative phosphorylation is 35%. Calculate the number of ATP generated by Complex I. Use 1 significant figure. The amount of ATP generated by Complex I is mol ATP. The equation for the overall reaction that occurs in Complex I is shown as: NADH + H+ + Q = NAD+ + QH2 Please explain! Thank you so much..
- ATP ADF R D Match the structure given with the name. Acetyl coenzyme A pyruvate Complex V of the electron transport - oxidative phosphorylation pathway. ATP Synthase Mitochondrion FAD COA not shown D с B AI. ATP Calculation A. Given that three molecules of glucose underwent full oxidation, how many of the following is produced in each phase? Show your solutions. Glycolysis NADH FADH₂ ATP NADH FADH2 A B C ATP (Substrate Level) SUM TOTAL J K D E [1] F Pyruvate Oxidation F If this happens in the liver, how many ATPs will be synthesized if all NADH and FADH₂ entered ETC.. Total number L M N G H I O Kreb's Cycle ATP Produced3. Fates of pyruvate. Pyruvate has several metabolic fates (some of which you'll learn later) but in anerobic conditions pyruvate has two outcomes. a. For these anerobic outcomes of pyruvate draw the reactions with names and structures of the reactants and products. Please name the enzymes and cofactors necessary. b. During strenuous activity, the demand for ATP in muscle tissue is vastly increased. In rabbit leg muscle or turkey flight muscle, the ATP is produced almost exclusively by lactic acid fermentation. ATP is formed in the payoff phase of glycolysis by two reactions, promoted by phosphoglycerate kinase and pyruvate kinase. Suppose skeletal muscle were devoid of lactate dehydrogenase. Could it carry out strenuous physical activity; that is, could it generate ATP at a high rate by glycolysis? Explain.
- stion 20 vet ered s out of g question Below is an image of how biotin is used in the reaction that converts pyruvate to oxaloacetate, an important metabolic reaction. The overall reaction is: Bicarbonate + ATP + pyruvate -> Oxaloacetate + ADP Which statement below is correct regarding biotin? xx-00 HO Bicarbonate HẠT NH Biotin Enz ATP Enol pyruvate ADP 2. NH Enz Carboxybiotin coo CIO CH₂ cooo Oxaloacetate HN NH Biotin O a. Biotin is a cofactor that serves as a reducing agent and is important for the generation of collagen O b. Biotin is a prosthetic group where the nitrogen serves as an electrophile and bicarbonate is a nucleophile O C Biotin is a cofactor that is covalently linked to the enzyme; the enzyme is a ligase6. Malate dehydrogenase catalyzes the following reversible reaction: COO- HO-C-H CH₂ COO™ L-Malate NAD+ y malate NADH + H+ dehydrogenase COO- 0=C CH₂ COO™ Oxaloacetate AG'° = 29.7 kJ/mol Malate + NAD+→NADH + H+ + oxaloacetate Calculate AG" and the ratio or products and reactants for the malate dehydrogenase reaction to proceed from left to right as shown. (The Faraday constant. 3, is 96.48 kJ/V-mol; RT(37°C)= 2.58kJ/mol) Steps: 1. Explain how you determined which molecule is an electron donor Malate and which is an acceptor NAD*. -2- 2. Calculate AED (write equation, then show calculations, for standard reduction potentials (E_values) see table in the posted lecture) 3. Calculate AG (write equation, then show calculations) 4. Calculate the ratio of products and reactants needed to for Malate + NAD+→→NADH + H+ + oxaloacetate reaction to proceed forward (write equation, then show calculations)Question 8: The following table shows the glycolysis reactions and their standard Gibbs free energy changes at 25 C. Answer the following questions: A. What is the Gibbs free energy expression of the glycolysis pathway? B. What is the overall reaction of the glycolysis pathway? C. Suppose that the physiological concentrations of some metabolites are known as follows:
- The Relative Efficiency of ATP Synthesis in Noncyclic versus Cyclic Photophosphorylation If noncyclic photosynthetic electron transport leads to the translocation of 7 H+/2e- and cyclic photosynthetic electron transport leads to the translocation of 2 H+/e-, what is the relative photosynthetic efficiency of ATP synthesis (expressed as the number of photons absorbed per ATP synthesized) for noncyclic versus cyclic photophosphorylation? (Assume that the CF1CF0-ATP synthase yields 3 ATP/14 H+.)Calculate AGo' for the reaction NADH + pyruvate → NAD+ + lactate You are given: Faradays constant F = 96.5 kJ/mol.V Eo' : NAD+ / NADH = 0.320V Eo' : Pyruvate/lactate = -0.185 V A. 13 kJ/mol В. 97 k j/mol С. 49 kJ/mol D. 26 k j/mol Е. None of the above B.What is the catalytic efficiency of Catalase ? Table. The values of KM and kcat for some Enzymes and Substrates Enzyme Carbonic anhydrase Substrate CO2 HCO3 KM (M) 1.2 x 10-2 2.6 x 10-2 Kcat (s-1) 1.0 x 106 4.0 x 105 Catalase H2O2 2.5 x 10-2 1.0 x 107 Urease Urea 2.5 x 10-2 4.0 x 105 O A. 4 x 108 M-s-1 O B. 4 x 108 M-1.s-1 OC25x 10-9 M-s1 D. 2.5 x 102 M-1.s-1 OE 1.0 x 107 s1