Mutant 1: Met-Pro-Trp-Pro-Glu-Lys-Cys Mutant 2: Met-Pro Mutant 3: Met-Pro-Cys-Gly-Pro-Lys-Met Mutant 4: Met-Pro-Trp-Pro-Lys-Asp Choose the correct type of mutation that occurred in the DNA to produce each mutant type. Nonsense Answer Missense Answer Addition Answer Deletion Answer

Mutant 1: Met-Pro-Trp-Pro-Glu-Lys-Cys Mutant 2: Met-Pro Mutant 3: Met-Pro-Cys-Gly-Pro-Lys-Met Mutant 4: Met-Pro-Trp-Pro-Lys-Asp Choose the correct type of mutation that occurred in the DNA to produce each mutant type. Nonsense Answer Missense Answer Addition Answer Deletion Answer

Name: Several genes code for enzymes that are responsible for histidine bios
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Several genes code for enzymes that are responsible for histidine biosynthesis in Escherichia coli. Part of the nucleotide sequence of the gene that codes for one of these enzymes is: AUG CCU UGG GCC CAA AAA UGC A series of mutants that have lost act

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

When the amino acid sequences of insulin isolated from different organisms were determined, differences were noted. For example, alanine was substituted for threonine, serine for glycine, and valine for isoleucine at corresponding positions in the protein. List the single-base changes that could occur in codons of the genetic code to produce these amino acid changes.
Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.
A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the same conditions. The normal and mutantpolypeptide differ by one amino acid. The fingerprints of the peptides obtained from the two polypeptides are shown below. What kind of amino acid substitution occurred as a result of the mutation? (That is, is the substituted amino acid more or less polar than the original amino acid? Is its pI lower or higher?) (Hint: Photocopy the fingerprints, cut them out, and overlay them.)
Pro-CHEMBIO peptide is a large peptide sequence with three disulfide bonds (indicated by the lines between cysteine residues). CHEMBIO Protease cleaves amide bonds between two basic amino acid residues to give the final peptide that is active in the body. The products of this protease reaction are: 1. Two chains that make up active CHEMBIO peptide, which contain the N- and C-terminus sections of the original Pro-CHEMBIO molecule 2. A separate inactive peptide What if instead of CHEMBIO Protease, this peptide was cleaved by trypsin? Indicate the cleavage locations on the structure below. asap
Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)
A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertion
A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
Many blood clotting proteins undergo a post-translational modification in which specific glutamic acid residues (Glu) in the protein are converted to gamma-carboxyglutamic acid residues (Gla). See reaction scheme below. An example is the blood clotting protein Factor IX, which has 12 Glu in its N-terminus converted to Gla. This modification gives Factor IX the ability to bind calcium and phospholipid membranes. Bacteria do not have the enzyme required to convert Glu to Gla and therefore Factor IX proteins expressed in bacteria would not have the proper modifications. How might you engineer the translational apparatus of a bacterial cell line so that it produces Factor IX with Gla in the appropriate positions. How would you ensure that only the 12 Glu in Factor IX that are normally converted to Gla and not just all Glu (Limit 5-6 senetnces)?
In studies of the amino acid sequence of wild-type and mutant forms of tryptophan synthetase in E. coli, the following changes have been observed: Determine a set of triplet codes in which only a single-nucleotide change produces each amino acid change.
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?
The following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.