For each of the following genotypes, explain how mutation (identified by a (-) willaffect the organism grown in lactose medium. Indicate whethera) B-galactosidase will be synthesized or not,b) synthesis of B-galactosidase is inducible (1) or constitutive (C) andc) growth of the organism will occur or not.a. I-P+O+Z+Y+A+b. I+P-O+Z+Y+A+c. I+P+O-Z+Y+A+d. I+P+0-Z+Y+A+/l+P+O+Z-Y-A-e. I-P+0+Z+Y+A+/l+P-O+Z+Y+A+

Answered: Image /qna-images/answer/4f1562cc-e684-4942-be5f-37dc6507a7dd.jpg

Answered: For each of the following genotypes,…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
A classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimethoprim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mammalian cell mutants defective in thymidylate synthase?
A classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimetho- prim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mam- malian cell mutants defective in thymidylate synthase?
For E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.
TRUE OR FALSE a) The structure of the purines and pyrimidines make them able to undergo keto-enol tautomerism. b) A unique 5'CCA terminal sequence is found in all tRNAs to be able to carry the correct amino acid to the ribosome.
The SARS-CoV-2 spike (S) protein and its sugars have been the subject of much scientific investigation. S protein, the main focus of SARS-CoV-2 vaccine development, is heavily glycosylated. In fact, it contains 22 N-linked, and at least two O-linked, glycosylation sites. Which of the following statements is most likely to describe this glycosylation process? a.) The SARS-CoV-2 spike protein is probably glycosylated in both the lysosomes and Golgi apparatus of cells in the respiratory tract of an infected subject. b.) The SARS-CoV-2 spike protein is probably glycosylated in both the endoplasmic reticulum and proteasomes of cells in the respiratory tract of an infected subject. c.) The SARS-CoV-2 spike protein is probably glycosylated in both the endoplasmic reticulum and Golgi apparatus of cells in the respiratory tract of an infected subject.
Given the following phenotypes, explain how the mutation (identified by a (-) superscript) will affect the E. coli grown in lactose medium. a. l+p+o+z-y+ b. i-p+o+z+y+ c. l+p+o-z+y+ d. l+p-o+z+y+
Pompe disease is a rare genetic condition resulting from a deficiency of the protein alpha-glucosidase. The following three mutations are among the 100+ mutations known or suspected of causing the disease. Context is provided in parentheses. Provide a brief hypothesis as to why the change would be damaging to the protein. a.) L571P (located in a helix buried in the protein interior)
Clary Fray used the pET vector system to express her prokaryotic amylase enzyme. She added peptone into her culture broth of BL21(DE3) Escherichia coli strain to induce protein expression. At the end of the experiment, she discovered that her protein was not expressed. She repeated three more times but her protein of interest was still not produced. (i) (ii) (iii) (iv) (v) Explain the reason why Clary failed to obtain her protein of interest and suggest a solution to troubleshoot this problem. Clary plans to express her protein along with a polyhistidine-tag. Explain the importance of His-tag in protein work. Is DH5a Escherichia coli suitable to propagate the plasmid before protein expression? Besides heat shock method, elaborate another procedure Clary could utilize to transform the recombinant pET vector into the host cell. If her supervisor instructs her to express a gene from gold fish (Carassius auratus), is the expression system she is using now suitable for this experiment?…
TRUE OR FALSE a) The electron rich nature and aromaticity of the nucleobases mediates their absorbance of UV light. b) Methylated and modified bases are commonly found in tRNA and rRNA.
A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.
A 19 year old female patient is diagnosed with chronic myelogenous leukemia. Karyotype analysis shows that the leukemic cells of this patient are heterozygous for a reciprocal translocation involving chromosomes 9 and 22. However, none of the normal, nonleukemic cells of this patient contain the translocation. a) Describe a molecular test to determine if chemotherapy given to the patient described would be completely succesful. (That is, devise a method to make sure that the patient's blood would be free of leukemic cells.) Be as specific as possible.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS