Missense mutations   a create premature stop codons   b cause no change in a gene product   c change the amino acid sequence of a polypeptide   d none of the above

Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes

A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…

Q: Transcription factors usually contain one or more motifs that play key roles in their function. What…

A: A transcription factor is a sequence specific DNA-binding factor and upon binding to the DNA…

Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…

A: Introduction  A mutation is a change in the DNA sequence that may occur due to incorrect…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Explain point  mutations and frameshift mutations. Which is more apt to disrupt the  structure and…

A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…

Q: کو اتار کر کے TATAAA box Translation initiation codon Intron 1 Exon 2 Intron 2 A. 5' Capping defect…

A: The answer is option           The answer is option (E). Protein truncation.

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: The RNA present in prokaryote and eukaryotic cells, where DNA is main genetic material, is called…

Q: Which of the following terms refer to the case when a mutation results in a significant decrease or…

A: The chenge in DNA sequence of an organisms is known as mutation.

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: A small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA…

A: A genetic mutation occurs after the formation of the DNA sequence has been altered. Some mutations…

Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…

A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…

Q: Which of the following is not possible?a. A nonsynonymous mutation in an intronb. A nonsynonymous…

A: Nonsynonymous mutations are those mutations that can change the protein encoded by mRNA and are…

Q: In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments.…

A: In 1964 Nirenberg and Philip Leder, a postdoctoral fellow at NIH, discovered a way to determine the…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: A missense mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon…

A:

Q: a. promoter region b. RNA polymerase C. antisense strand d. poly-A tail e. 5' cap f. splicing 8.…

A: Introduction :- A promoter is a DNA region where RNA polymerase starts transcription of a gene.…

Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…

A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…

Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…

Q: . By inspecting Table 4.5, discuss how the genetic code has evolved to help minimize the impact of…

A: A genetic code is a set of three nucleotide bases that is used to translate information encoded in…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Use the Genetic Code below to help you answer the following questions.  The nucleotide sequence of…

A: Mutation is the change in the genetic makeup of the organism, mutation particularly in the genes can…

Q: A point mutation is a mutation that arises when one nucleotide in the genetic sequence is…

A: Mutation is the change in the DNA sequence or change in the entire chromosome that ultimately can…

Q: a) The genetic code in unambigous that means many codons can code for the same amino acids. b)…

A: 1.  The genetic code is UNAMBIGUOUS:- Means that each triplet specifies only a single amino acid.…

Q: Define the following terms: a. open reading frame b. degenerate coding system c. nonoverlapping…

A: Note: Since you have posted a question with multiple subparts, we will solve the first three…

Q: Which type of point mutation does not affect the resulting protein? a deletion b missense mutation…

A: A mutation is any alteration or change in the sequence of the genetic material (DNA or RNA). A point…

Q: Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: result

A: Transition mutation is nothing but the replacement of one purine nucleotide with other and one…

Q: Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA…

A: Introduction : Mutations are modifications to the genetic sequence. Mutations can involve the…

Q: What type of mutation causes the "mutant" variety of the PTC gene?  a A point mutation which lead…

A: PTC gene: it is the premature translation-termination codon. PTC is responsible for about one third…

Q: The initiation factors a. help assembling both ribosomal subunits with mRNA and initiator tRNA b.…

A: initiation factors bind to the repressors to regulate the process of translation  there are three…

Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?

A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…

Q: Hypertrophic cardiomyopathy is caused by mutations in the β-myosin heavy chain gene. One common…

A: Codons are triplets of nucleotides that codes for an amino acid. The ribosome read the codons in a…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C   A  T  G Changes to A  T  C…

Q: 43. What did the Meselson-Stahl experiment demonstrate? A. The conservative mechanism of DNA…

A: What does meselson and Stahl experiment demonstrate? Meselson and Stahl experimented using E. coli…

Q: Identify the best match between the mutation description and term.   a. Transversion: results in a…

A: Often mutation occurs in our body. These mutations can be beneficial or lethal. The mutation occurs…

Q: Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two…

A: a mutation occurred in the codon below and an A was inserted between the two Ts T  T  G chnages to T…

Q: Considering only the listed genetic elements in the figure below, how many different mRNAs and…

A: Ribosomes have the ability to convert every mRNA molecule into polypeptides. Beginning with the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.