The initiation factors a. help assembling both ribosomal subunits with mRNA and initiator tRNA b. help with the peptide bond formation c. help starting the translation elongation d. are responsible for the initiation of ribosome translocation
Q: Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular…
A: Answer - This tRNA would carry the amino acid Serine to the ribosome. mRNA carries codon. tRNA…
Q: After being irradiated, the gene coding for the E site is mutated, causing the E site to have a…
A: The process of the formation of RNA from DNA is called transcription. The process of the formation…
Q: Use the pre-mRNA sequence shown below to answer the following questions. MRNA:…
A: Splice sites are recognized by GU (5' splice site) and AG (3' splice site), which signals the…
Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…
A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…
Q: A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that…
A: The normal mRNA is 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ The bases in bold form the start codon.…
Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…
A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…
Q: Provide the correct sequence of steps in each process described below. Write the letters in series…
A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…
Q: Synonymous mutations are: O a. a change from a stop codon to an amino-acid coding codon. O b.…
A: Genes are the units (physical and functional) of heredity, made up of DNA or deoxyribonucleic. They…
Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…
A: Arginine is coded by six mRNA codons.
Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…
A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…
Q: Mutation of which of these sequences would have an effect on translational initiation? A. 3’ UTR…
A: Introduction Prokaryotic transcription is the process by which prokaryotic genetic material is…
Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…
A: DNA to mRNA is transcription and mRNA to protein is translation.
Q: which signal serves a similar function as the Shine-Dalgarno Sequence in prokaryotes? A. The…
A: The Shine–Dalgarno sequence is a ribosomal binding site in prokaryotic mRNA, generally located…
Q: 9The table opposite shows the triplet codes for the 20 amino acids involved in protein synther A…
A: Codons are three DNA sequence triplets that code for specific amino acids and there are a total of…
Q: a. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next…
A: When the DNA that is already transcribed to RNA inside the cell ribosomes helps this mRNA to…
Q: The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was…
A: The synthesis of RNA (ribonucleic acid) from DNA (deoxyribonucleic acid) by the enzyme RNApolymerase…
Q: 1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA…
A: Transcription is the process of copying information from a strand of DNA to a newly synthesized…
Q: Choose best match of the events that occur during translation with their locations in the E. coli…
A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…
Q: 1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ mRNA: polypeptide chain:
A: (According to our regulations, we are required to answer only the first question in case of multiple…
Q: During translation, ____________ is the step in which new t-RNA is attracted to the ribosome (a)…
A: Translation is the process in which proteins are synthesized by ribosomes. Translation occurs after…
Q: A nonsense mutation Select one: a. results in a larger protein being produced from the mutated gene…
A: Introduction :- There are a number of disorders known to be caused by nonsense mutations, including:…
Q: During translation elongation, in which site do new tRNAs enter? a) D site b) E site c) A site…
A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…
Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.
A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…
Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…
A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…
Q: In the triplet-binding assay of Nirenberg and Leder, an RNA triplet composed of three bases was able…
A: Introduction In 1964, two eminent scientists Marshall W. Nirenberg and Philip Leder carried out the…
Q: At least one nonsense suppressing tRNA is knownthat can suppress more than one type of…
A: tRNA is a transfer ribonucleic acid. It is a type of RNA which decodes the messenger RNA and form a…
Q: Translational control is usually aimed at preventing the initiation of translation. With regard to…
A: The process of translating the sequence of mRNA into an amino acid sequence is called translation.…
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…
A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…
Q: A mRNA strand is 5’ to 3 across the translation initiation complex. The start codon is ____ And…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: briefly explain the importance of the degeneracy of the genetic code in the translation process.
A: The genetic code can be defined as a collection of rules that living cells use to translate…
Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…
A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…
Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…
A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…
Q: What is an example of a post translational modification? a. Poly (a) tail b. 5' capping c.…
A: Following protein production, covalent and typically enzymatic modifications to proteins are…
Q: The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. b) Which of the 3 types…
A: RNA may be a single-stranded macromolecule that's composed of three main elements. The central dogma…
Q: The peptide bond formation a. occurs when two tRNAs are located inside the P and A site in the…
A: Given: The peptide bond formation.
Q: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of…
A: Selection of the AUG start codon for translation in eukaryotes is governed by codon-anticodon…
Q: A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary…
A: Answer- The formation of mRNA from the coding strand of the DNA is called translation. It happens in…
Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…
A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices. in…
Q: a) What is genetic code and What are the properties of genetic code b) Explain the role of…
A: During the translation process, the genetic code from the mRNA is transcribed into amino acids and…
Q: Transcribe and translate the following sequence of DNA: ATGAAGTTACCC. There is a mutation that…
A: Transcription is the synthesis of pRNA with the template DNA. Translation is the synthesis of…
Q: The release factors RF1 and RF2 are required for
A:
Q: Use the pre-mRNA sequence shown below to answer the following questions. MRNA:…
A: The intron boundary (5' splice site) generally starts with GU sequence. The consensus sequence of 5'…
Q: Comment on the accuracy of the aminoacylation during the charging of tRNA to ensure the fidelity of…
A: Amino acid activation or commonly known as tRNA charging, refers to the attachment of an amino acid…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The central dogma of life involves three processes. They are: Replication: - In this process,…
Q: Elongation factor __________ reactivates arrested RNA polymerase II
A: Molecular biology is the branch of science that studies the structure, composition, function, and…
Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…
A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…
Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…
A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…
Step by step
Solved in 2 steps
- Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translationTranscription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNACharging tRNAs entail: O All of these choices are correct. O Proper recognition between the anticodon and codon. Forming an ester linkage at the tRNA's 3'OH with the amino acid. ATP. O The use of aminoacyl tRNA synthases.
- Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)A cluster of ribosomes. In a polysome, or polyribosome, the polypeptides associated with which ribosomes will be the longest: a. They will be the same length since the rate of translation is constant. b. Those at the 3'-end3'-end of the mRNA. c. Those at the 5'-end5'-end of the MRNA. d. Those in the middle of the mRNA.Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
- Translation. Write the anti-codon sequence of the MRNA transcript. Translate the MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter abbreviation. ANTI-CODON 3' 5' SEQUENCE AMINO ACID N- C- SEQUENCE (3 letter terminus Abbreviation) Terminus AMINO ACID N- C- SEQUENCE (1 letter terminus Abbreviation) TerminusRNA processinga. removes the exons, leaving only the introns.b. is the same as transcription.c. is an event that occurs after RNA is transcribed.d. is the rejection of old, worn-out RNA.e. All of these are correct.codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
- Genetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tailRow A B. C D Process 1 transcription transcription translation Protein Synthesis in an Animal Cell Select the row below that correctly identifies the name of Process 1 as well as a sequence that could represent Structure 1. Sequence of Structure 1 CGA ATT GTA CAA CGA AUU GUA CAA CGA ATT GTA CAA CGA AUU GUA CAA translation Structure 1 Process 1 Structure 2 ORA Process 210. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an