LO 48- Identify molecules and sequences involved in gene regulation of eukaryotes Match each example below to the correct regulatory sequence/element. gypsy is a sequence in Drosophila that has an inhibitory effect on enhancers, controlling the expression of affected genes. gypsy is a(n) Insulator The ability to produce lactase is associated with a mutation 13,910 bp upstream of the lactase gene. This mutation is probably located in a(n) Activator Answer 1: Insulator Answer 2: Activator

LO 48- Identify molecules and sequences involved in gene regulation of eukaryotes Match each example below to the correct regulatory sequence/element. gypsy is a sequence in Drosophila that has an inhibitory effect on enhancers, controlling the expression of affected genes. gypsy is a(n) Insulator The ability to produce lactase is associated with a mutation 13,910 bp upstream of the lactase gene. This mutation is probably located in a(n) Activator Answer 1: Insulator Answer 2: Activator

Name: LO 48-Identify molecules and sequences involved in gene regulation of
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: LO 48-Identify molecules and sequences involved in gene regulation of eukaryotesMatch each example below to the correct regulatory sequence/element.gypsy is a sequence in Drosophila that has an inhibitory effect on enhancers, controlling the express

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 35CTQ: Protein modification can alter gene expression in many ways. Describe how phosphorylation of...

See similar textbooks

Similar questions

Protein modification can alter gene expression in many ways. Describe how phosphorylation of proteins can alter gene expression.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Part I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'
. Why is a nonsense suppressor tRNATyr, even though ithas a mutant anticodon that cannot recognize a tyrosinecodon, charged with tyrosine by Tyr tRNA synthetase?
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translation
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
Plz answer ASAP. I will thumb up You are studying the regulation of the lactose operon in Escherichia coli, by measuring expression of the lacZ gene (i.e production of beta-galactosidase).(a) You identify several loss-of-function mutations in which lacZ is never expressed, in the presence and absence of glucose and lactose. What components of the lac operon could be mutated to produce this phenotype? List all possibilities.
Searching the yeast Saccharomyces cerevisiae genome, researchers found approximately 4,000 DNA sites with a sequence which could potentially bind the yeast transcription factor GAL4. GAL4 activates the transcription of galactose genes. Yet there are only 10 GAL4-binding sites which control the genes necessary for galactose metabolism. The GAL4 binding sequence is CGGAT#AGAAGC*GCCG, where # is T, C or G, and * is C or T. In one chromatin immunoprecipitation experiment (ChIP), yeast growing on galactose were lysed, and subjected to cross-linking reagents which cross-linked transcription factors and activators to DNA. Next the DNA was sheared into small fragments, and antibodies to GAL4 were added. These antibodies coprecipitated the GAL4 and the DNA it was cross-linked to. The cross-linking was then chemically reversed, and the DNA was isolated, cloned into a library of plasmids and sequenced. Results showed that only 10 different DNA sequences had GAL4 bound. Since the…
Choose all that apply regarding gene transcription in eukaryotes: Multiple transcription factors are necessary to form the pre-initiation complex (PIC) of RNA Pol II. The 5' cap of mRNA requires the free triphosphate on the nucleotide at the 5' end. Introns must be removed from the initial RNA transcipt. Histone acetylation is a method controlling gene expression. Acetylation creates more positive charges on histones, leading to tighter binding of the proteins to DNA. Exons are removed from mRNA by the spliceosome. RNA polymerase II must completely finish an mRNA transcript before processing can begin. RNA polymerase I catalyzes the synthesis of the majority of ribosomal RNA. The hormone 173-estradiol binds to a G-protein coupled receptor to control gene transcription.
. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?
Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in question #6. 5’ ATG GGA GAT TAT TAG 3’ (non-template strand) 3’ TAC CCT CTA ATA ATC 5’ (template strand) What would be the mRNA sequence when this mutated DNA is transcribed? What would be the resulting amino acid sequence when your answer to 7a is translated?