In mice, the autosomal locus coding for the β-globinchain of hemoglobin is 1 m.u. from the albino locus. Assume for the moment that the same is true in humans. The disease sickle-cell anemia is the result ofhomozygosity for a particular mutation in theβ-globin gene.a. A son is born to an albino man and a woman withsickle-cell anemia. What kinds of gametes will theson form, and in what proportions?b. A daughter is born to a normal man and a womanwho has both albinism and sickle-cell anemia.What kinds of gametes will the daughter form,and in what proportions?c. If the son in part (a) grows up and marries thedaughter in part (b), what is the probability that achild of theirs will be an albino with sickle-cellanemia?

Q: The Drosophila gene Sex lethal (Sxl) is deserving of itsname. Certain alleles have no effect on XY…

A: Hello! Since you have posted multiple questions, we are answering only first two questions. If you…

Q: a. What type of inheritance is shown in the pedigree? 1 II 1 2 4 II 1 2 3 4 5 IV 1 Identify the…

A: Pedigree is a chart that represents members of a family affected by a genetic trait. Here, squares…

Q: This pedigree depicts the inheritance of the mitochondrial disease Leber hereditary optic neuropathy…

A: Inheritance through mitochondria is a special type of inheritance. The genetic deformity is in…

Q: a. The Y axis is the strength of association between prostate cancer and the variant. b. The spike…

A: Genome-wide association studies are used to identify genetic variations in genes associated with a…

Q: Briefly discuss why mutant allele 1 fails to produce functional protein. Note that this mutation has…

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: The chromosomal sequences of two mutant alleles of gene A from patients with the zero subtype…

A: DNA is the genetic material. An alteration in the DNA sequence of an organism by the substitution or…

Q: Osteogenesis imperfecta () is a genetic disorder linked to mutations in the genes that encode the…

A: Osteogenesis is the process of bone formation in the human body. It involves the development and…

Q: In references to the "alpha-globin gene locus" or "beta-globin gene locus", the term "locus" means

A: Chromosomes are condensed form of chromatin. Chromosomes consist of two chromatids which are held…

Q: Bombay effect.

A: The Bombay effect is a phenomenon depicted by the H antigen, which is responsible for the expression…

Q: Multiple T/F: A. Individuals with the common allele are expected to have identical DNA sequences at…

A: Beta globin locus is mainly made up of five genes that are located on a short region of Chromosome…

Q: Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity…

A: The SCN9A gene encodes for a sodium ion channel that is dependent on voltage. It is composed of 26…

Q: Given a mutation in the promoter, coding region, and/or non-coding region of a gene, explain how…

A: The mutation is a sudden heritable change in the genetic makeup of a cell which mostly results in…

Q: One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is…

A: Hypokalemic periodic paralysis is a condition characterized by intermittent episodes of muscle…

Q: 2. DNA profiles can be used to identify unknown victims from a natural disaster. A DNA sample from a…

A: Hi, Thanks For Your Question.  Q. 2 Answer :

Q: en prior to stem cell transplant may be associated with gonadal failure. Risk is least with…

A: Chemotherapy is a cancer treatment that uses powerful drugs to kill or slow down cancer cells. It…

Q: Mention Mendelian laws and how they fit in with sickle cell anaemia Are there any advantages to…

A: Introduction :- Sickle cell anaemia is an inherited red blood cell condition in which the body's…

Q: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG…

A: A mutated sequence can fail to produce a functional protein due to formation of a non-sense codon or…

Q: What characteristics of the pedigree suggest that pancreatic cancer in this family is inherited as…

A: Introduction  Pedigree Analysis: This is the new approach to study the inheritance pattern in the…

Q: 20.TRC is a non mendelian trait. A.what is the mode of inheritance of total ridge count (TRC) in…

A: A mendelian trait is a trait that follows patterns of inheritance set forth by Gregor Mendel in his…

Q: Let's say an autosomal gene undergoes mutation in a population of 28 barn cats to become a new…

A: Allele fixation is a phenomenon in which the gene pool changes from carrying at least two allelic…

Q: a. For the E.coli haploid genotype below, determine the phenotype for the following proteins. Assume…

A: Lac operon Lac operon or the lactose operon is a gene expression system in E Coli. and many similar…

Q: When the organization of adjacent genes with highly similar sequences is in an inverted orientation,…

A: The physical unit of heredity is known as the gene. The term "inversion" refers to a mutation that…

Q: a. How many generations are presented in this pedigree? b. What are the most probable genotype of…

A: Pedigree It is a diagrammatical representation of the inheritance of a trait over several…

Q: A man in his early 30s suddenly developed weakness in hishands and neck, followed weeks later by…

A: Myotonic dystrophy (DM) is the second most frequent type of muscular dystrophy. In the most severe…

Q: This pedigree traces the inheritance of a rare disease in humans. a. Based on this pedigree, is the…

A: Answer is given below.

Q: The HbβS(sickle-cell) allele of the human β-globingene changes the sixth amino acid in the…

A: Sickle cell anemia is a blood disorder in which an improper folding of hemoglobin occurs. In this…

Q: A. Deletion of the SOX9 gene leads to sex reversal resulting in a person with karyotype 46XY being…

A: Males more prone to genetic disorders: X-linked recessive diseases most often occur in males. Males…

Q: Which pathology leads to an increased risk of Alzheimer’s disease? Select one: a. Accumulation of…

A: Alzheimer's disease is a progressive disorder which affects the brain cells to waste away…

Q: 8 7 6 5 2 3 II I-1 1-2 2 1 2 3 4 5 6 7 8 [= II-1 11-2 11-4 II-5 11-6 II-7 II-8 11-3

A: Pedigree - Pedigree analysis is a chart that represents a family tree, which displays the members…

Q: When the His− Salmonella strain used in the Ames testis exposed to substance X, no His+ revertants…

A: The Ames test, named after the developer Bruce Ames, is a chemical method to test chemicals such as…

Q: Cornelia de Lange syndrome (CdLS) is a rare humandisease caused by a dominant loss-of-function…

A: Hi there! Since you have posted multiple questions, we are answering only first two sub-parts.…

Q: A particular type of anemia in humans, called b-thalassemia,results from a severe reduction or…

A: A disease is a state of unhealthiness of the physical body, mind and social interaction. A disease…

Q: Assume that curly hair (C) is dominant to straight hair. Albinism (P ) is recessive to normal skin…

A: A genetic trait is considered dominant if it is expressed in a person even in its single copy. While…

Q: can two observably different cells have the same geno type, explain?

A: In biology, the genotype is the set of genes in our DNA which is responsible for a particular trait.…

Q: The inheritance pattern of a rare form of Xeroderma pigmentosum is exhibited in the pedigree shown…

A: a. Because of the autosomal recessive inheritance pattern, this pedigree is autosomal recessive.  1.…

Q: Based on the information provided, you can infer that individual III-1 inherited both the      A.)…

A: A pedigree is a graph that shows how a characteristic or medical condition is passed down via family…

Q: Given that II2 has cystic fibrosis, what is the chance that III8 will be a carrier of the CF allele?…

A: Cystic fibrosis (CF)  Is one of the most common hereditary disorders, affecting approximately one…

Q: A man in his early 30s suddenly developed weakness in hishands and neck, followed weeks later by…

A: Introduction  A genome is consisting of transcriptionally active genes. These genes form mRNA as…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.