In a series of infection experiments, a researcher discovers that the ID50 value for the infectious bacterium Parasiticum mucoides is 2,000, and that the ID50 for another infectious bacterium, Donoteatum thisbacterium, is 150. Given these data, a person exposed to 1,000 bacteria of each type would be more likely to be infected by which bacterium? There is no way to know given the information provided Both infections are equally likely Donoteatum thisbacterium Parasiticum mucoides

In a series of infection experiments, a researcher discovers that the ID50 value for the infectious bacterium Parasiticum mucoides is 2,000, and that the ID50 for another infectious bacterium, Donoteatum thisbacterium, is 150. Given these data, a person exposed to 1,000 bacteria of each type would be more likely to be infected by which bacterium? There is no way to know given the information provided Both infections are equally likely Donoteatum thisbacterium Parasiticum mucoides

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter9: Parenteral Medication Labels And Dosage Calculation

Section: Chapter Questions

Problem 1.1P

See similar textbooks

Similar questions

In a series of infection experiments, a researcher discovers that the ID50 value for the infectious bacterium Parasiticum mucoides is 2,000, and that the ID50 for another infectious bacterium, Donoteatum thisbacterium, is 150. Given these data, a person exposed to 1,000 bacteria of each type would be more likely to be infected by which bacterium? O Parasiticum mucoides O Both infections are equally likely Donoteatum thisbacterium There is no way to know given the information provided MacBook Air DD F9 80 000 000 F8 F7 F6 F5 F4 F3 *
This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids
Write a paragraph for when you once have Neisseria gonorrhoea bacteria in its pure form, what methods can you use to confirm the identity of this bacterium as N. gonorrhoeae? Mention what is the principle of those methods.
The genera Streptococci and Staphylococci are important bacterial groups to study as they contain many human pathogens. In the following question, choose whether the stated characteristic is typical of either Streptococci, Staphylococci, or both by bolding or highlighting the correct choice. Choose One a. Gram-positive cocci bacteria Streptococci, Staphylococci, Both b. Can withstand higher osmotic pressure Streptococci, Staphylococci, Both c. Principle pathogen is S. pyogenes Streptococci, Staphylococci, Both d. MRSA pathogen Streptococci, Staphylococci, Both e. B-hemolytic pharyngitis (throat infection) Streptococci, Staphylococci, Both
Describe the lines of proof Robert Koch used to definitivelyassociate the bacterium Mycobacterium tuberculosis with thedisease tuberculosis. How would his proof have been flawedif any of the tools he developed for studying bacterialdiseases had not been available for his study of tuberculosis?
The volume of E. coli added to each warm agar pour/virus mixture was originally100µL. After pre-testing the experiment, the instructions were modified for you to add 300µL of E. coli. Make an educated guess as to why the volume was increased.
Suppose you do this test on a hypothetical Staphylococcus species with the antibiotics pencilllin (p-10) and chloramphenicol (C30). You record identical zone diameters of 25 mm for the chloramphenicol and penicillin disks. Which antibiotic would be less effective against this organism? Penicillin falls to the left of the resistant zone Penicillin falls to the right of the suceptible zone zone Chlorampenicol falls to the left of the resistant zone Chlorampenicol falls to the right of the suceptible zone none of these
You are treating swimming pools with ozone. You are using 0.02 ppm ozone to kill adenovirus, with an exposure time of 30 minutes. Will this treatment be effective on 2 log adenovirus ? Will this treatment also kill E. coli in the same water ? Explain your answer with calculations
Suppose your professor handed you a test tube with 2.0 mL of M. foliorum infected with bacteriophage T4 in it and told you to make a 10-2 dilution of the entire culture. Explain how you would do this. Show your calculations.
Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is one experiment you could do, involving culturing the organism?
Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is a procedure you could do, involving making a slide of the organism?
A patient admitted to the hospital for fever and coughing is diagnosed with an active tuberculosis infection, and is treated with an antibiotic named rifampin. The antibiotics seemed successful, and his subsequent tests for tuberculosis came back negative. However, he was re-admitted to the hospital two months later with similar symptoms, was treated with rifampin again, and died of respiratory failure shortly thereafter. It was concluded that he had been infected with an antibiotic-resistant strain of M. tuberculosis. Does this situation meet the criteria for evolution by natural selection? Briefly explain how each of Darwin’s postulates is met/not met: a. Individuals in a population vary in traits. b. Traits are heritable. c. More offspring are produced than can survive, and only some individuals survive and reproduce. d. Individuals with certain heritable traits are more likely to survive and reproduce than others.