In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive 14C-cysteinyl-tRNACys (charged tRNACys + cysteine). They then removed the sulfur group from the cysteine, creating alanyl-tRNACys (charged tRNACys + alanine). When alanyl-tRNACys was added to a synthetic mRNA calling for cysteine, but not alanine, a polypeptide chain was synthesized containing alanine. What can you conclude from this experiment?

Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…

A: In eukaryotic organisms, the gene contains introns as well as exons.  Eukaryotic genomes are much…

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: RNA splicing is the process of removal of non coding sequences called as introns and joining of…

Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…

A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…

Q: Bacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated…

A: The transcription in prokaryotes is either terminated by rho-dependent or rho-independent process or…

Q: Why is the base pairing in D N A important? How does mRNA production in eukaryotes differ from the…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide sequences which curl around…

Q: if a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV…

A: The molecular weight of a Protein can be accurately predicted if the amino acids making up the…

Q: Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by UAC and…

A: Given  Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: Translation is the process of formation of protein using the information encoded in the mRNA. mRNA…

Q: The peptidyl binding (P) site of the ribosome is always oriented toward the 5’ end of the mRNA while…

A: The complementary bases binding between two strand of RNA or DNA takes place with opposite polarity.

Q: Which of the following feature of mature mRNAs protects them from premature degradation by cellular…

A: Introduction  Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that matches to a…

Q: Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this…

A: Translation occurs when the mRNA gets attached to the ribosome and subunits and the initiation…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: Which of the following is not involved in the elongation of prokaryotic peptide? a. EE-Tus, EE-Ts,…

A: The translation is the process by which protein is synthesized with the help of mRNA, tRNA, and…

Q: The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified…

A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: The translation is a process in which the transcribed messenger RNA (ribonucleic acid) is decoded by…

Q: The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E.…

A: Bacterias are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…

Q: The figure provided in in the introduction above shows adenine being deaminated to form the…

A: Wobble hypothesis - is about the base pairing between nitrogen bases in 1st and 2nd positions of the…

Q: In eukaryotic cells, mRNAs have been found to have a circular arrangement in which proteins hold the…

A: In the context of cell biology, the rate of mRNA translation into cellular proteins called…

Q: A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP.…

A: Introduction: The process in which RNA is synthesized from DNA is known as transcription. Therefore,…

Q: If the mRNA transcribed for this gene will be translated into a functional protein, how many amino…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Alternative splicing is a process that enables a messenger RNA to direct the synthesis of different…

Q: Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your…

A: Rho utilization site , also known by the acronym rut is a sequence of RNA in bacteria upstream of…

Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…

A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…

Q: An important validation of the genetic code occurred when George Streisinger determined the amino…

A: It is given that the specific single-base insertion mutation could be suppressed, with wild-type…

Q: You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations…

A: Hi! Thank you for the question. As you have posted a question with multiple subparts, I will be…

Q: If a mutation were found where additional five G/C (top/bottom) base pairs were inserted immediately…

A: The mutation is a sudden and heritable change in the sequence of an organism's genome that gives…

Q: When scientists cut a eukaryotic gene from genomic DNA, they discovered that enabling the strands to…

A: Alternative splicing is a method through which a messenger RNA may control the creation of many…

Q: What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating…

A: The messenger RNA (mRNA) is a molecule produced during the process of transcription where the enzyme…

Q: peptide bonds between adjacent amino acids requires peptidyl transferase enzyme activity, which is…

A: The enzymatic activity of ribosome is called as peptidyl transferase activity. The site of catalysis…

Q: Which of the following RNAs are required for translation? (Choose all that apply) tRNA rRNA…

A: Adenine, guanine, cytosine, and uracil make up RNA, which is a polymer of nucleotides composed of a…

Q: A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The anticodon of the tRNA is 3'-UAC-5', and it binds to a codon in an mRNA with the sequence…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: Translation is the process of translating a messenger RNA (mRNA) molecule into the amino acid…

Q: Select all of the factors in the list below that play a role in the translation initiation of…

A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: If mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and…

A: DNA is the genetic material and is present in the nucleus of the eukaryotic cells.

Q: Which of the following anticodons of a tRNA molecule can base pair with three different codons on an…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than…

A: Genetic code is defined as the set of nucleotides which determine the sequence of DNA of a given…

Q: Given the following MRNA sequence, what is the amino acid sequence of the polypeptide that will be…

A: The mRNA is read in the 5' to 3' direction by the transcription machinery to produce the polypeptide…

Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation…

A: Virus are mostly pathogenic forms which neither considered to be living or non-living outside the…

Q: eliminating the intron RNA immediately after it is excised from the pre-mRNA?

A: As we know that, the process of removing the introns and rejoining the coding section or exons ,of…

Q: Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a.…

A: Nucleotides  The bases found in the molecules of DNA are known as nucleotides. They are the building…

Q: Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this…

A: Messenger (mRNA) ribonucleic acid helps in the formation of protein as it contains the long base…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: The amino acids are the building blocks of the protein; the amino acids are the small molecules that…

Q: Which of the followings indicate the order of procaryotic mRNA degreadation?   cleavage of the…

A: Messenger RNA (mRNA) acts as the template for protein synthesis. Though mRNA is associated with…

Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…

A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…

Q: One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine –…

A: DNA and RNA are polynucleotides, i.e., they are polymers of nucleotides. DNA stores genetic…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: The amino acids are the building blocks of the protein; the amino acids are the small molecules that…

Q: Which of the following mRNA codons signals the start of translation in eukaryotic cells? 5’-UGA-3’…

A: There are 3 stop codons: UAG(Amber) UAA(ochre) UGA(umber) These codons signal the termination of…

Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…

A: Introduction The central dogma of molecular biology describes the flow of genetic information from…