Use the following DNA sequence, and write the resulting messenger RNA sequence

Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the MRNA sequence below: UAACUAAGGAUGUAGUUAUG

Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000 (include the comma)

How many amino acid are in each of the two polypeptides produced? And how many nucleotides long would the final processed mRNA made from the gene be?

(b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…

Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG

Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I first attempted this question I identified the open reading frame as starting from ATG. However I was told that my reading frame was wrong and that the frame should include an asparagine group but how it that possible?

A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.

Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)

5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd G