Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW ON PAPER

Shown is a sequencing gel. Read the sequence off the gel and determine the first 4 nucleotides (or bases) based on the fact replication occurs 5¹ to 3¹. A I G C Answer:

Answer the following 2 questions based on the given sequence of DNA.  The top strand is the template strand:   5’-CGTATAGCTCAGGGCGCTAACCTTAGCATGGACG-3’ (Template) 3’-GCATATCGAGTCCCGCGATTGGAATCGTACCTGC-5’ (Coding)

For each term in the left column, select the term which best matches. 1. deoxyribonucleotide 2. nitrogenous base thymine + deoxyribose 3. deoxynitronucleoside guanine + deoxyribose + phosphate group 4. polydeoxyribonucleotide DNA 5. deoxyribonucleoside 6. nitrogenous base

The following is the base sequence on the coding strand of a DNA molecule: AAT GCC AGT GGT TCG CAC   Coding DNA:  _________________________________________Template DNA:  _________________________________________   mRNA:          _________________________________________   Amino acids:   _________________________________________   Mutation 1   A) Coding DNA: _________________________________________Template DNA:  _________________________________________   mRNA:              _________________________________________   B) amino acids:  _________________________________________

DNA structure depends on base pairing of its four nucleotides, A, C, T, and G. Nucleotide A pairs with T, and nucleotide C pairs with G. This forms a four-letter DNA “alphabet." Because DNA codes for amino acids in sets of three nucleotides, there are 4 cubed (4'), or 64, possible combinations, coding for 20 different amino acids. What is the best explanation for why there is no selective advantage for DNA to have five nucleotides (e.g., A, C, T, G, and E) with C pairing with either G or functionally equivalent E? It would be impossible to form the DNA molecule, because it must have an equal number of Cs and Gs. Because G and E have the same role, there would still be four functional letters of the alphabet. Replication would be inaccurate because sometimes C would bond with G and sometimes C would bond with E. There would be a five-letter alphabet with 125 combinations, which is too numerous. It is impossible because there are not five known nucleotides in the cell.

Label the diagram to the corresponding letter

Write the sequence of the DNA strand complementary to the following strand: AAATTTCGATCCCGGGAAATTTAGACCCGGGTTTAAACCCCGCAT

Fill in each blank with the correct answer please.

Draw a DNA structure that includes at least two criss crosses There must be 5 nucleotide pairs above and below each intersect. Label §Adenine §Thymine §Guanine §Cytosine §Phosphates §Sugars §Hydrogen bonds Color code each part and provide a key