i.) Fill in the table for each of the E. coli: (0) = No Activity (+) = Basal Activity and (+++) = High Activity %3D %3D E. coli chromosome F' Plasmid B-gal activity? Permease activity? When When When When Glucose is Lactose is Glucose is Lactose is present present present present a.) I+ P+ O+ Z+ Y+ none +++ +++ b.) I^[S] P+ O+ Z+ Y+ none c.) I+ P+ O^[c] Z+ Y+ none d.) I+ P+ O- Z- Y+ none e.) I+ P+ O+ Z+ Y+ I^[S] P+ O+ Z+ Y+ f.) I^[S] P+ O+ Z- Y+ I+ P+ O^[c] Z+ Y- g.) I^[TB] P+ O+ Z+ Y 1+ P+ O^[c] Z- Y+ h.) I+ P+ O^[c] Z+ Y- I+ P+ O+ Z** Y+ i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+ Z** is a polar mutation ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of ß-galactosidase protein activity with and without lactose present, why?

i.) Fill in the table for each of the E. coli: (0) = No Activity (+) = Basal Activity and (+++) = High Activity %3D %3D E. coli chromosome F' Plasmid B-gal activity? Permease activity? When When When When Glucose is Lactose is Glucose is Lactose is present present present present a.) I+ P+ O+ Z+ Y+ none +++ +++ b.) I^[S] P+ O+ Z+ Y+ none c.) I+ P+ O^[c] Z+ Y+ none d.) I+ P+ O- Z- Y+ none e.) I+ P+ O+ Z+ Y+ I^[S] P+ O+ Z+ Y+ f.) I^[S] P+ O+ Z- Y+ I+ P+ O^[c] Z+ Y- g.) I^[TB] P+ O+ Z+ Y 1+ P+ O^[c] Z- Y+ h.) I+ P+ O^[c] Z+ Y- I+ P+ O+ Z Y+ i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+ Z is a polar mutation ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of ß-galactosidase protein activity with and without lactose present, why?

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter16: Adult And Pediatric Dosages Based On Body Surface Area

Section: Chapter Questions

Problem 7.2P

See similar textbooks

Similar questions

b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response
In E. coli, Base excision repair (BER) handles non-bulky lesions (e.g., deamination, oxidation) and nucleotide excision repair (NER) handles bulky lesions (e.g., Py dimers). Is this statement true or false? O True False
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
For each of the following mutant E. coli strains,plot a 30-minute time course of concentration ofβ-galactosidase, permease, and acetylase enzymesgrown under the following conditions: For the first10 minutes, no lactose is present; at 10 minutes, lactosebecomes the sole carbon source. Plot concentration onthe y-axis, time on the x-axis. (Don’t worry about theexact units for each protein on the y-axis.)a. I− P+ o+ Z+ Y+ A+ / I+ P+ o+ Z− Y+ A+b. I− P+ ocZ+ Y+ A− / I+ P+ o+ Z− Y+ A+c. IsP+ o+ Z+ Y+ A+ / I− P+ o+ Z− Y+ A+d. I− P− o+ Z+ Y+ A+ / I− P+ ocZ+ Y− A+e. I− P+ o+ Z− Y+ A+ / I− P− ocZ+ Y− A+
Under what conditions will the following partial diploid strain of E. coli convert chorismate to tryptophan (assume trp mutants function similarly to lac mutants)? trpR* trpP trpO* trpE* trpD* trpC* trpB* trpA*/ trpR trpP trpO° trpE trpD trpC trpB trpA ect the one BEST answer (2 oints! O never O only when tryptophan levels are low O constitutively O only when tryptophan is present O only when chorismate levels are low
b. Neurospora has an arginine amino acid synthesis pathway shown below: ornithine citrulline arginine NH H2N H2N OH H2N HO HO NH2 NH2 ÑH2 Enzyme A Enzyme B Enzyme C ↑ ↑ Gene A Gene B Gene C Suppose I have a neurospora strain that has a mutation such that it will not grow unless I supplement the media (food) with arginine (but not with citrulline or ornithine). What gene is mutated? Explain your reasoning. C. Suppose I take the strain above that only grows with arginine supplements and cross it to a different mutant Neurospora strain that grows with arginine and citrulline supplements but not ornithine supplements. Assming genes A, B and C are unlinked and there is only one mutation per strain: i) What percentage of the progeny will grow on ornithine? ii) What percentage on citrulline? iii) What percentage on arginine? Show your work for i), ii) and iii). |
Last week in lab you plated various E. coli mutants. This week we will be analyzing those plates. To help interpret those results, predict the growth/color pattern you'd expect for a Lacz- mutant. Table 1: Options are blue or white for NA plates; Table 2: Options are: growth or none for minimal plates). Table 1 [Select] Table 2 [Select] Xgal glucose Xgal + lactose [Select] [Select] Minimal lactose ΝΑ [Select] Xgal + IPTG [Select] maltose > [S
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACСАТТАТАССССТАСGTGATAG...5" promoter a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'
The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACCATTATАССССТАСGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?
. Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: