Assume a 5250 base pair, closed circular plasmid with 10 negative supercoils. (a) Calculate the values of twist (T), writhe (W), and linking number (L) for this plasmid (use 10.5 base pairs/turn for B-DNA) (b) Your starting plasmid is now A-DNA instead of B-DNA. What is the linking number required to have 10 negative supercoils in this plasmid?

How many fragments and how big each fragment should be after digesting the plasmid with BamHI? How many fragments and how big each fragment should be after digesting the plasmid with PvuI? How many fragments and how big each fragment should be after digesting with both enzymes? Show your calculation/explanation.

Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene.    a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligase

Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece

Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.

and set up a series of four dideoxy reactions (the dideoxy nucleotides are labeled with radioactive P32 ).    You then separate the products of the reactions by gel electrophoresis and obtain the following banding pattern:      a) Write out the base sequence of the newly synthesized strand from reading the gel (include the 5’ and 3’; end)  b) Write out the base sequence of the original fragment you were given (include the 5’ and 3’ end)

Can you please help with 1f please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC and…

A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA?   a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb   b. 2.0kb   c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp   d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp

The transformation results below were obtained with 10 ul of intact plasmid DNA at nine concentrations. The following numbers of colonies are obtained when 100 ul of transformed cells are plated on selective medium: Fill in the following table: Concentration # colonies DNA mass of Fraction of Mass Transformation PGREEN (Concentration x volume OR X spread = x 10ul plasmid solution) PGREEN in cell Cell efficiency Y÷ A suspension suspension spread = 100 ul - total vol cell susp. (Colonies - Mass spread) C x Z = A See (510 ul) HINT: this calculation is constant Given= X Given=Y С. Z. 0.00001 ug/ul | 4 0.00005 ug/ul 12 0.0001 ug/ul 0.0005 ug/ul 32 125 0.001 ug/ul 442 0.005 µg/ul 0.01 ug/ul 0.05 ug/ul 0.1 ug/ul 542 507 475 516 0.5 ug/ul 505

Assume that a plasmid is 4700 base pairs in length and has restriction sites for a given restriction enzyme at the following locations: 800, 1400, 2900, and 3600. List the fragments by size that are ! expected when the plasmid is fully digested the restriction enzyme.