Formation of an Hfr cell Chromosome -F plasmid The F plasmid sometimes integrates into the bacterial chromosome by homologous recombination, generating an Hfr cell; the process F pilus F* cell Integrated is reversible. F plasmid Hfr cell Formation of an F' cell - Integrated F plasmid - Chromosome An incorrect excision of the Hfr cell integrated F plasmid brings along a portion of the F plasmid chromosome, generating an F' cell. Chromosomal DNA- F pilus F' cell FIGURE 8.23 Formation of Hfr and F' Cells An Hfr cell is created when the plasmid integrates into the chromosome as a result of homologous recombination. Note that the process is reversible. An F' cell is created when certain recombination events result in an incorrect excision that removes a piece of the chromosome along with the F plasmid. This process is also reversible.

Formation of an Hfr cell Chromosome -F plasmid The F plasmid sometimes integrates into the bacterial chromosome by homologous recombination, generating an Hfr cell; the process F pilus F* cell Integrated is reversible. F plasmid Hfr cell Formation of an F' cell - Integrated F plasmid - Chromosome An incorrect excision of the Hfr cell integrated F plasmid brings along a portion of the F plasmid chromosome, generating an F' cell. Chromosomal DNA- F pilus F' cell FIGURE 8.23 Formation of Hfr and F' Cells An Hfr cell is created when the plasmid integrates into the chromosome as a result of homologous recombination. Note that the process is reversible. An F' cell is created when certain recombination events result in an incorrect excision that removes a piece of the chromosome along with the F plasmid. This process is also reversible.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 6QP: Recently, scientists discovered that a rare disorder called polkadotism is caused by a bacterial...

See similar textbooks

Similar questions

Arial BIUA 11 + .. | I 1 I 3 I 4 i.) Fill in the table for each of the E. coli: (0) = No Activity (+) = Basal Activity and (+++) = High Activity E. coli chromosome F' Plasmid B-gal activity? Permease activity? When When When When Glucose is Lactose is Glucose is Lactose is present present present present a.) I+ P+ O+ Z+ Y+ Inone +++ +++ b.) I^[S] P+ O+ Z+ Y+ none c.) I+ P+ O^[c] Z+ Y+ none d.) I+ P+ O- Z- Y+ none e.) I+ P+ O+ Z+ Y+ I^[S] P+ O+ Z+ Y+ f.) I^[S] P+ O+ Z- Y+ I+ P+ O^[c] Z+ Y- g.) I^[TB] P+ O+ Z+ Y 1+ P+ O^[c] Z- Y+ h.) I+ P+ O^[c] Z+ Y- I+ P+ O+ Z** Y+ i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+ Z** is a polar mutation ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of ß-galactosidase protein activity with and without lactose present, why? MacBook Air 000
2 3 inte tion of Lormhda. ne att si ucated betwee de ne att sites and go ns one te n vacter aged ot utilize doot ractose ato la t don s gal* uc Integration to form prophage om SOward cor coct some cro on! ni imple ex 2 3 bio* gal* 14. The figure provided portrays the integration of Lambda phage into a host chromosome at the att site, located between the gal+ and bio+ genes. This prophage may disintegrate from the host carrying with it host genes, such as gal+ and/or bio+ and go on to transduce another host bacterium. How would one determine if a gal- host bacterium's phenotype was changed from gal- to gal+? To clarify, the minus version cannot utilize galactose as a carbon source for growth because it does not produce galactase, the enzyme that hydrolyzes galactose into monomeric sugars. There is a straight forward answer/solution to this – do not concoct some crazy solution! Think simple experiment.
If you extract the DNA of the coliphage φ X174, you willfind that its composition is 25 percent A, 33 percent T,24 percent G, and 18 percent C. Does this compositionmake sense in regard to Chargaff’s rules? How wouldyou interpret this result? How might such a phage replicate its DNA
Conjugation depends on direct cell-to-cell contactbetween a donor F+ carrying either a conjugative________ (the F plasmid) or an integrated conjugativeelement (as in Hfr strains), and a recipient lacking suchan element (F−).
As described in Figure, host DNA is hydrolyzed into smallpieces, which are occasionally assembled with phage proteins, creatinga phage with bacterial chromosomal DNA. If the breakage ofthe chromosomal DNA is not random (i.e., it is more likely tobreak at certain spots as opposed to other spots), how might nonrandombreakage affect cotransduction frequency?
Define/Compare/Contrast/Distinguish these three terms: F plasmid F’ plasmid (and how is it formed) Hfr cell (and how is it formed)
Experimentally, when an E. coli bacterium already has a λ prophageintegrated into its chromosome, another λ phage cannot usually infectthe cell and establish the lysogenic or lytic cycle. Based on yourunderstanding of the genetic regulation of the phage λ reproductivecycles, why do you think the other phage would be unsuccessful?
Before JCVI-syn3.0 was produced, what steps were used to create a synthetic Mycoplasma cell? Put the events below into the correct order. Drag and drop the events into the proper sequence from left to right. ▸ View Available Hint(s) First Step Transformed cells are detected by the presence of lacz, which causes them to cleave Xgal and produce a blue color. Yeast is transformed using Mycoplasma mycoides fragments. The synthetic chromosome is transformed into Mycoplasma capricolum. The synthetic Mycoplasma mycoides chromosome is purified. DNA fragments assemble through homologous recombination in yeast. Reset Help Last Step
You are interested in synthesizing a variant of Synechocystis sp. pcc 7803 ferredoxin having mutation (E) at its 38th residue. The gene is encoded in a pET21b vector (5.3 kbp). If you use 0.10 ng of the template plasmid (pET21b SynFd), calculate the ratio of the original to the mutated gene after 10 versus 20 cycles.
The protein of T2 bacteriophage is labeled with 35S and the DNA with 32p. Where would one detect most of the 32p if the T2 bacteriophage were allowed to infect the bacteria? O on the phage coat surrounding the T2 bacteriophage on the membrane of the infected bacteria O inside the T2 bacteriophage capsid O inside the infected bacteria O The 32P would be equally distributed within the T2 bacteriophage and infected bacteria
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Bacteriophage-Inspired Antibiotics Although bacteriophages have been infecting bacteria for billions of years, no mechanism, has evolved in bacteria to prevent the viruses from lysing the cell walls of their hosts. Now, scientists are targeting the same bacterial wall components that bacteriophages do. The goal is to develop antibiotics that bacteria will be less likely to develop resistance to. FIGURE 20.22 shows the results of a study to test Epimerox, a new bacteriophage-inspired antibiotic, against Bacillus anthracis, the bacterial species that causes the disease anthrax. FIGURE 20.22 Effect of Epimerox on the survival of mice with anthrax. Mice were infected with the bacteria B. anthracis. One group of 15 then began receiving a drug-free buffer solution 3 hours later. Another 15 were treated with Epimerox beginning 3 hours after infection. A third group of 15was treated with Epimerox beginning 24 hours after infection. How long did it take for all the mice that received the drug-free buffer alone to die? What function did this group play in the experiment?