The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’

summarize these results using concise language in a neat table;   Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…

Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.

This is the pre-mRNA of a mammalian gene with the spice sites marked.   5’-AGCUUCGCGUAAAUCGUAG/GUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAG\GGCUUUGG   ACCGAUAGAUGCGACCCUGGAG/GUAAGUAUAGAUAAUUAAGCACAG\GCAUGCAGGGAUAUCCU   CCAAAUAG/GUAAGUAACCUUACGGUCAAUUAAUUAG\GCAGUAGAUGAAUAAACGAUAU   CGAUCGGUUAG/GUAAGUCUGAU-3’   This is the spliced mRNA with the spliced sites marked with a vertical line, “|”.                                     5’-AGCUUCGCGUAAAUCGUAG|GGCUUUGGACCGAUAGAUGCGACCCUGGAG|GCAUGCAGGGAUAUCCU CCAAAUAG|GCAGUAGAUGAAUAAACGAUAUCGAUCGGUUAGGUAAGUCUGAU-3’ Translate this mammalian mRNA into the correct amino acid sequence.  In your answer, use the three letter abbreviations for each amino acid.