FIGURE 5-11 After conjugation, crossovers are needed to integrate genes from the donor fragment into the recipient's chromosome and, hence, Crossovers integrate parts of the transferred donor fragment Hfr F- become a stable part of its genome. LaunchPad ANIMATED ART: Bacterial conjugation and recombination Transfer of single-stranded DNA copy b- a Exconjugant Transferred fragment converted into double helix Exogenote Endogenote- Recombinant -Lost Double crossover inserts donor DNA Putting all these observations together, Wollman and Jacob deduced that, in the conjugating Hfr, single-stranded DNA transfer begins from a fixed point on the donor chromosome, termed the origin (O), and continues in a linear fashion. The point O is now known to be the site at which the F plasmid is inserted. The farther a gene is from 0, the later it is transferred to the F~. The transfer process will generally stop before the farthermost genes are transferred, and, as a result, these genes are included in fewer exconjugants. Note that a type of chromosome map can be produced in units of minutes, based on time of entry of marked genes. In the example in Figure 5-12, the map would be:

FIGURE 5-11 After conjugation, crossovers are needed to integrate genes from the donor fragment into the recipient's chromosome and, hence, Crossovers integrate parts of the transferred donor fragment Hfr F- become a stable part of its genome. LaunchPad ANIMATED ART: Bacterial conjugation and recombination Transfer of single-stranded DNA copy b- a Exconjugant Transferred fragment converted into double helix Exogenote Endogenote- Recombinant -Lost Double crossover inserts donor DNA Putting all these observations together, Wollman and Jacob deduced that, in the conjugating Hfr, single-stranded DNA transfer begins from a fixed point on the donor chromosome, termed the origin (O), and continues in a linear fashion. The point O is now known to be the site at which the F plasmid is inserted. The farther a gene is from 0, the later it is transferred to the F~. The transfer process will generally stop before the farthermost genes are transferred, and, as a result, these genes are included in fewer exconjugants. Note that a type of chromosome map can be produced in units of minutes, based on time of entry of marked genes. In the example in Figure 5-12, the map would be:

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter17: Bacterial And Viral Genetics

Section: Chapter Questions

Problem 1ITD

See similar textbooks

Similar questions

You are analyzing the intracellular DNA intermediates formed during the replication of the single-stranded (ss) DNA phage M13. In a replication mutant, you find accumulation of DNA molecules with the following properties:Results of a 0.7% agarose gel electrophoresis run at pH 8.0 – gel is running top tobottom, with the origin at the top of the diagram. The smudges indicate several bandswith slightly different migration rates. open circle M13closed circle M13 Left lane — markers (wild-type open circle M13 and closed circle M13)2nd lane — DNA extracted from mutant M13 phage cells3rd lane — DNA extracted from mutant M13 phage cells denatured4th lane — DNA extracted from normal M13 phage cellsRight lane — DNA extracted from normal M13 phage cells denaturedProfiles from a 5 – 20% sucrose gradient centrifuging of the mutant M13 phage DNA The arrow on the neutral (pH 7.4) gradient shows the position of the covalently closed circular DNA. On the alkaline (pH 12.5) gradient, note two peaks…
By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample of theirexperimental results is shown in the table:Draw a map that shows the order of genes and the locations ofthe origins of transfer among these different Hfr strains?
Suppose that you wanted to study retroviral integration mechanisms by determining the nucleotide sequence at the integration site-sev- eral dozen nucleotides on each side of the viral-cellular DNA junc- tion. Describe how to isolate DNA containing a junction site in amounts sufficient for sequence analysis.
Sal1 Xho1 Insert pUC cloning vector MCS Insert Digested with Sal1 on the left and Xho1 on the right Sal1 Ori Vector Digested with Sal1 Xho1: СТСGAG Sal1: GTCGAC RE cut site Part B) After 8 h of sleep, you realize your mistake above (Question 3 Part A), and you successfully transformed your plasmid and obtained a subset of white colonies and blue colonies on the plate. Question: You conclude that all the blue colonies contain a plasmid O With the insert in the LacZ screening marker With the insert in the Antibiotic selectable marker O Without an insert in the LacZ screening marker O None of the above + Lacz alpha AmpR
In two isolates (one is resistant to ampicillin and theother is sensitive to ampicillin) of a new bacterium,you found that genes encoding ampicillin resistanceare being transferred into the sensitive strain. . To determine if the gene transfer involves transformation, conjugation, or transduction, you separatethe ampicillin-resistant and ampicillin-sensitivestrains by a membrane with pores that are smallerthan the size of a bacterium, but larger than thesizes of bacteriophage or DNA fragments. If genetransfer is still observed, what mechanisms arepossibly involved and which are excluded?
By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample oftheir experimental results is shown in the following table: A. E xplain how these results are consistent with the idea that thebacterial chromosome is circular.B. Draw a map of the bacterial chromosome that shows the orderof genes and the locations of the origins of transfer among thesedifferent Hfr strains.
When the interrupted mating technique was used withfive different strains of Hfr bacteria, the following orders ofgene entry and recombination were observed. On the basisof these data, draw a map of the bacterial chromosome.Do the data support the concept of circularity?HfrStrain Order1 T C H R O2 H R O M B3 M O R H C4 M B A K T5 C T K A B
In a bacterial culture in which all cells are unable to synthesizeleucine (leu-), a potent mutagen is added, and the cells areallowed to undergo one round of replication. At that point, samplesare taken, a series of dilutions are made, and the cells areplated on either minimal medium or minimal medium containingleucine. The first culture condition (minimal medium) allowsthe growth of only leu+ cells, while the second culture condition(minimal medium with leucine added) allows growth of all cells.The results of the experiment are as follows: Culture Condition Dilution ColoniesMinimal medium 10-1 18Minimal medium + leucine 10-7 6What is the rate of mutation at the locus associated with leucinebiosynthesis?
During horizontal gene transfer, all of the following can be transferred EXCEPT (which statement is false?): O donor transposon DNA O recipient DNA O donor plasmid DNA O donor chromosomal DNA prt sc F10 home F9
during bacterial transformation, DNA that enters acell is not an intact chromosome; instead it consists ofrandomly generated fragments of chromosomal DNA.In a transformation where the donor DNA was from abacterial strain that was a+ b+ c+ and the recipient wasa b c, 55% of the cells that became a+ were also transformed to c+. But only 2% of the a+ cells were b+. Isgene b or c closer to gene a?
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Researchers who study the molecular mechanism of transformationhave identified many proteins in bacteria that function in theuptake of DNA from the environment and its recombination intothe host cell’s chromosome. This means that bacteria have evolvedmolecular mechanisms for the purpose of transformation by extracellularDNA. What advantage(s) does a bacterium derive from importing DNA from the environment and/or incorporating it into its chromosome?