ETETETE AT Hidden Markov Model (HMM) Construct the HMM for the following sequences A C. A A. C. A. A The matches are considered for the columns that don't have any gap 2) A A C. A A. A T. C. A A A The matches are considered for the columns [1, 2,4,5, and 7]
Q: Calculate the DN/DS ratio for the sequences below. TTT ACT AAT AGT TTC CCT AAC GAT
A: A codon is a combination of three nucleotides that codes for an amino acid. A single codon codes…
Q: Identify a problem in molecular biology and how to use CRISPR/cas 9 system to solve it.
A: "CRISPR" is "clustered regularly interspaced short palindromic repeat". It's a piece of DNA that…
Q: The technique of fluorescence in situ hybridization (FISH) is described. This is another method for…
A: Fluorescence in situ hybridization (FISH) is a technique used to study the genome complexity. FISH…
Q: (a) Why can there be multiple codons for an amino acid? Why would this have evolved? (b) What is…
A: The genetic code comprises the set of rules that tells how the four nucleotide bases in the DNA are…
Q: In extracting and Isolating a DNA from yeast and fruit. • What is the role of salt and dishwashing…
A: DNA is the genetic material of most cells and its extraction is necessary for analysis,…
Q: In the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is…
A: The sequence logo helps in predicting certain gene features. Gene features such as the ribosome…
Q: You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST…
A: a. The codon has a property which is known as degeneracy of the codon .This means that the codons…
Q: What is a BLAST search? a. A mechanism for aligning consensus regions during wholegenome…
A: BLAST or Basic Local Alignment Search Tool, is a program used in bioinformatics for the comparison…
Q: a Given the following restriction map of a cloned 10 kb piece of DNA, what size fragments would you…
A: The process of fragmenting deoxyribonucleic acid strands with specific enzymes is restriction…
Q: b - Construct the HMM for the following sequences where the matches are considered for the columns…
A: Hi dear,as you gave two questions I have answered the complex question.please repost other question…
Q: a. Explain how the sea urchin and salmon data demonstrate both of Chargaff’s rules b. How…
A: Chargaff's rule is for double standard DNA are: 1. The molar ratio of A to T equals to 1. Similarly,…
Q: You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base…
A: the mutation is the change or error that is caused in the chromosome it is of a different type 1.…
Q: Genome comparisons have suggested that mouse DNA has mutated about twice as fast as human DNA. What…
A: Answer: Introduction: Genetically modified mice are required widely in research as models of human…
Q: While comparative genomics is fundamentally the study of the differences between the genomes of…
A: Comparative genomics is the study of genetics and other elements of biology by comparing the genomes…
Q: a To make a genomic library useful for sequencingan entire genome, why would you ordinarily fragment…
A: Hi there! Since you have posted multiple questions, we are answering only first two sub-parts. A…
Q: Two sequences aligned using one of the BLAST programs produce an alignment with an expected value…
A: *A BLAST alignment will have an pair of sequences in which every letter in one sequence is paired…
Q: What information can be obtained from DIS80 primer Blast ? A Respect length and number in alleles…
A: Primer-BLAST used for design a new target-specific primers in one step . Primer BLAST check the…
Q: When working with the gel electrophoresis chamber, what must we keep in mind? A. Keeping the gel…
A: Gel electrophoresis technique of separation of molecules on the basis of their size and charge under…
Q: Explain the sequencing-by synthesis (SBS) approach ?
A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…
Q: Considering the technologies that pave the way for the identification of molecules on the basis of…
A: Within the scope of recombinant DNA technology, the technologies that pave the way for the…
Q: Briefly describe the applications of SNPs in DNA typing.
A: SNPs : Small nucleotide polymorphisms . It is a variation at a single position in a DNA sequence…
Q: Describe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are…
A: Chain terminating sequencing is also known as Sanger sequencing which is based on amplification of…
Q: Explain how substitution matrices can be used to improve the possibility of identifying related…
A: Protein is a macronutrient that is vital for building muscle mass. It is normally found in creature…
Q: What is the best analysis for estimation of family sequence conservation of domains? Enlist any two…
A: A gene is the basic physical and functional unit of the heredity. Genes are composed of the DNA.…
Q: Question 2. Using the sequences and scoring scheme provided in Question 1, compute the most optimal…
A: A computer programming technique called dynamic programming aids in the speedy resolution of a class…
Q: (a) Explain sensitivity and selectivity in terms of true and false positives. (b) What is the…
A: Needleman–Wunsch algorithm is an algorithm used in bioinformatics to align the nucleotide and…
Q: Use a drawing to illustrate the principle of DNA gel electrophoresis. Indicate roughly the…
A: Gel electrophoresis technique is used to separate DNA, RNA and proteins depending on their molecular…
Q: "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?
A: Introduction The cDNA library is a collection of mRNA segments cloned into independent vector…
Q: Can Bioinformatics be used for sequence annotation to identifyprotein-coding and noncoding sequences…
A: The genome sequence of any organism is that organism's blueprint: the set of instructions dictating…
Q: Consider three different kinds of human libraries: agenomic library, a brain cDNA library, and a…
A: There are two types of human libraries. These are genomic library and cDNA library. The human…
Q: A.In your own words, explain the meaning of “Conjugation” and give an example of its use with a…
A: INTRODUCTION The transfer of genetic material between bacterial cells is…
Q: Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the EcoRI…
A: No, because most humans genes are much longer than 4kb.
Q: Select all that apply: A SNP (single nucleotide polymorphism) is similar to an STR (short tandem…
A: SNP and STR loci are explored for human identity testing projects, mitochondrial DNA testing, and…
Q: As a molecular biologist and horticulturist specializing in snapdragons, you have decided that you…
A: Genomic libraries contain an entire genome of a species as a collection of random DNA fragments. The…
Q: Where do you expect to see multiple “Ns” within a sequencing read? a)Within the first 25…
A: Nucleotide sequences have their role in every aspect of genetic machinery. This includes…
Q: "Whole-Genome Sequencing Is Widely Used for Sequencing and Assembling Entire Genomes". Explain this…
A: Whole genome sequencing It reveals an organism's complete DNA make-up ( allowing us to better…
Q: write down the applications of pair wise and multipal sequence alignment in the field of…
A: Multiple sequence alignment or MSA of nucleic acids i.e. DNA, RNA and proteins is nowadays one of…
Q: In large-genome sequencing projects, the initial data usually reveal gaps where no sequence…
A: Primer walking or directed sequencing is a sequencing method for sequencing DNA fragments that are…
Q: Based on the sequence data below. Which of the indicated sections of the sequence can you trust to…
A: DNA (Deoxyribonucleic acid) sequencing is an essential component of molecular biological studies.…
Q: The best molecular technique to quantify the gene transcripts is (write in fu!!).
A: The Central Dogma concept states that "DNA makes RNA and RNA makes protein". This concept is…
Q: Explain how a multiple sequence alignment can identify functional sites in a genetic sequence.
A: Sequence alignment can be defined as the pattern of arranging the sequences of DNA, RNA, or protein…
Q: To achieve a 10x depth coverage for a genome of length 10 Mbp, how many reads of 100 bp are…
A: A Coverage is multiplier based on total size of the genome. Formula = Coverage = (read length) x…
Q: Describe Shine Dalgarno sequences
A: The process of translation is formation of a polypeptide chain from an mRNA sequence. This requires…
Q: List down and briefly describe three other sequence alignment tools other than BLAST used in…
A: BLAST can rapidly align and compare a query DNA sequence with a database of sequences, which makes…
Q: Hidden Markov Model (HMM) Construct the HMM for the following sequences
A: Introduction A hidden Markov model (HMM) is a statistical model which will be used to describe the…
Q: For the hybridization step in the Southern blotting, the hybridization was done at 85 degrees…
A: Southern blotting is the most common molecular biology technique. A Southern blot is defined as a…
Q: (a) Is it biologically advantageous that DNAis stable? Why or why not? (b) Is it biologically…
A: The two major types of nucleic acids are DNA and RNA. They are made from nucleotides, containing a…
![TTT
TTET
Search (Alt+Q)
of
G.
G.
A
Enable Editing
A.
T.
A
Help
A.
A.
A.
A.
A.
Saved to this PC
Review
A.
it's safer to stay in Protected View.
Hidden Markov Model (HMM)
T.
Construct the HMM for the following sequences
A.
1)
A.
C.
The matches are considered for the columns that don't have any gap
2)
The matches are considered for the columns [1, 2,4,5, and 7]](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F92dfb885-0181-4550-9110-689703e3ee99%2F25e0561b-6e1f-44f0-b85d-5192d7aa9bf1%2Ff2p1fdc_processed.jpeg&w=3840&q=75)
Step by step
Solved in 3 steps with 1 images
- Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?Why a multiple sequence alignment is needed for researchers? What inferences can be derived from this kind of sequence alignments? Explain two extreme cases that are non-informative for the multiple sequence alignment.2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked with designing 2 primers to clone this gene by PCR amplification. What are the sequences of the two 21bp primers in the 5' to 3' orientation that will allow you successfully amplify this gene? АTGTTTGTTTTТСTTGTTTTATTGCCACTAGTCTСТAGTCAGTGTGTTAATCTTACAАССAGAACTCAАТТАСССССТGСАТАСАСТААТСTTTCАCАC GACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAA O A) ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA O B) TAAAACAAGAAAAACAAACAT and TTATGTGTAATGTAATTTGAC O C) ATGTTACTTGGTGACCAGTTG and GTCAAATTACATTACACATAA O D) ATGTTTGTTTTTCTTGTTTTA and TTATGTGTAATGTAATTTGAC
- Align two sequences: horizontal – GGAATGG, vertical – ATG, m= 2, mm = 0, g/o = -2, g/e = -1. Complete the NW matrix below and show the alignment paths. Write down and score all optimal alignments. Part 2. Dynamic Programming Assignment, Needleman-Wunsch Algorithm, Affine Gap Cost Click the shapes and move them using arrow keys (or drag). Click the shapes and right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in MS Word). 0000 Align and score all optimal alignments here. 0000Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisRecall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP sites flanking a gene for neomycin resistance (Fig. 18.11a). AloxP site is only 34 base pairs long, as shown in thefollowing figure.ATAACTTCGTATA ATGTATGC TATACGAAGTTATInverted repeat Spacer Inverted repeatExplain how you could use PCR to generate a neomycin resistance gene flanked by loxP sites, starting witha plasmid containing a neorgene. If you had the intronof the target gene cloned in a plasmid vector, howcould you insert your PCR product into the intron?
- O e. Gene amplification CLEAR MY CHOICE To study the function of any gene of interest you would perform the loss and gain of function approaches by either deleting or re-expressing the gene of interest, which of the following can be used to determine and quantify the activity of the gene? Oa. Western blotting O b. Gene knockdown O. PCR/OLA O d. Microscopy O e. DNA hybridization Paternity testing can be detected most precisely by using techniqueCheck all the statements that are TRUE regarding 16S or ITS (microbiome) illumina (NGS) sequencing vs. whole genome illumina (NGS) sequencing. A. You don't need to trim the reads for 16S sequencing, but you do for whole genome sequencing. B. Whole genome sequencing files will have more reads in them because genomes are bigger than 16S amplicons. C. The read alignment and contig assembly steps would probably be harder for whole genome sequencing. D. The 16S molecules being sequenced are always DNA, while for whole genome sequencing they could be RNA or DNA going into the illumina sequencer. E. NGS for 16S and whole genome sequencing can both use sample indexes/barcodes to maximize efficiency. F. Whole genome sequencing doesn't necessarily require you to know any of the sequences/targets before hand to design specific primers for.From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created? and why it is referred to as “hybridization technology”? B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment? C- Mention the name and the color of the dyes used in expression microarray? D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?
- HUAWEI Nova 2 Plus DUAL CAMERA Real-time PCR is used in many applications, in which of the following applications you need the step of reverse transcription? Select one or more: O a. Gene transcription quantification Ob. in DNA genotyping OC. Any time we run a Real-time PCR O d. When amplifying a gene of interest O e. In gene copy number detection The non-nucleoside inhibitors are supposed to be a better choice to treat hypermethylated genomes because: O a. They bind and interfere with the methylating enzyme. O b. They can convert cytosine into thymine. Oc. They can convert thymine into cytosine. O d. They can bind to the promoter region and prevent methylation. e. They can convert the methylated cytosine into thymine. 80 NEXT PAGEwhat is the whole-genome shotgun sequencing? Also briefly explain its strategy to assemble the genome sequence.Explain why DNA ladders are usually included during gel electrophoresis. One aspect of PCR that can be modified is the annealing temperature. In general, higher annealing temperatures show more specificity towards a single template, whereas lower annealing temperatures show less specificity and may bind to multiple regions throughout the genome. Discuss how using an annealing temperature that is too high or too low might influence the results of a PCR assay (and gel electrophoresis results) such as the one used in this study.