In extracting and Isolating a DNA from yeast and fruit. • What is the role of salt and dishwashing liquid in the extraction/isolation of DNA from yeast and fruit ? EXPLAIN !!
Q: 2B. S. aureus hemolysin B attacks the RBC cell membrane by hydrolyzing the sphingomyelin headgroup:…
A: Sphingomyelin is a phospholipid with sphingosine as platform molecule and phosphocholine as head…
Q: ou've been tasked with observing the motility of an UNKNOWN Bacteria isolated from a mixed culture.…
A: Bacteria is the tiny cellular living structure which belong to the Moneran kingdom. The bacteria…
Q: Which of the following is true of guanine? Select all that apply. a Guanine has a one-ring…
A: Purine : Have double ring structure Pyrimidine: Have single ring structure
Q: A protein molecule is approximately spherical and has a hydrodynamic diameter of 35μm. What is the…
A: The protein interaction is classified as one of the most important and fundamental steps in the…
Q: The enzyme that catalyzes the conversion of glucose to mannose is classified as a a. Isomerase b.…
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases…
Q: Give 3 similarities between the lock and key model and the induced fit model 2. Give 3 differences…
A: The main difference between the advertised balance and lock and the key model is that in the…
Q: An enzyme A is most active at 37oC. Which of the following change will increase the activity of A?…
A: Enzymes are catalysts that are globular proteins. These catalysts influence the rate of a reaction…
Q: draw 3 allosteric enzyme curves for glycogen synthesis in the presence of high AMP, high NADH, and…
A: An allosteric enzyme is one that comprises a very small region that helps them in adapting to…
Q: True or false. If the statement is false, change the underlined words. Glyceraldehyde is an example…
A: Biological macromolecules can be divided into 4 classes: Nucleic acid, Proteins, Lipids and…
Q: lease help me answer questions 71 & 77 71. Which of the following are examples of kinetic energy? A.…
A: Introduction: Kinetic energy: The term energy is the ability to do work or cause change. There are…
Q: 2. Reaction Mechanism and Molecularity Step 1 (slow): O3+ NO2 NO3 + O2 Step 2 (fast): NO, + NO: NO…
A: Molecularity is defined as the total number of molecules that participate in the reaction…
Q: Please explain how glycolysis is linked to the CAC.
A: CAC : Citric acid cycle Pyruvate : Glycolysis end product Glycolysis, the CAC are linked via the…
Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: how essential is water in our body? Please expand your answer and give examples
A: Water is the solvent of life. It is the most abundant substance in the living systems. It makes up…
Q: Trypsin and pepsin are both important proteases but they differ markedly with respect to: O aqueous…
A: "Since you have posted multiple questions we will answer the first question for you. If you want…
Q: Amylose and amylopectin are the fractions of starch having glucose molecules as monosaccharide units…
A: Starch is the stored form of carbohydrate present in plants. The glucose molecules are joined by the…
Q: 1)What are the main roles of the following amino acids; (within the crystal structure and/or active…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: An analyst designed a pair of primers to detect the presence of Alu sequence in human DNA genome…
A: PCR stands for a polymerase chain reaction. PCR is carried out under in-vitro or test tube…
Q: 1. Sodium error encountered in using a pH meter causes a/an increase in the pH reading of a solution…
A: We'll answer the first three questions since the exact one wasn't specified. Please submit other…
Q: Tabulate the total number of ATP equivalents that would be produced by the metabolism of the…
A: The given phospholipid has glycerol, a sugar (glucose), a phosphate group, and two fatty acids…
Q: 7. Which of the following best characterizes the events that occur at an origin of DNA replication?…
A: Replication is the process of duplication of individual strands of a double stranded DNA. The…
Q: 2- one liter of buffer solution contains 0.1 mole of benzoic acid and 0.2 mole of sodium benzoate…
A: Given Values: pKa of benzoic acid = 4.19 Moles of benzoic acid in buffer = 0.1 moles Moles of sodium…
Q: i need the answer quickly
A: Thiamazole is a drug used for treatment of disease hyperthyroidism. Thiamazole mode of action…
Q: How many moles of ATP can be obtained from palmitic acid? Show your solution.
A: The fatty acids that are released in the digestion of triglycerides are broken down in a series of…
Q: 1x10exp-7 From the following enzyme-catalyzed kinetic data, estimate K, and V, 'm m 25 20 15 10 1…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: disease. As such, a frontline treatment for Type 2 diabetes is the drug metformin, which acts…
A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first…
Q: What is the difference between a nucleoside and a nucleotide? Provide examples.
A: Nucleic acids are important to all life forms. They exist in two types DNA and RNA. Nucleic acids…
Q: 4. You are to choose the members of an expedition that will climb several high mour Each applicant…
A: Hemoglobin abnormalities are referred to as the type of blood disorders that have a major impact on…
Q: Please explain the Warburg Effect and how it is used to detect tumors.
A: Warburg effect is phenomenon commonly used to detect the cancerous cells. The detection of cancer…
Q: 3. Which of the following processes involves DNA ligase? A. Primer synthesis B. Removal of DNA…
A: DNA is called deoxyribonucleic acid. DNA act as genetic material in most organisms. DNA is a…
Q: Jungkook was tasked to ensure that an enzyme responsible for keeping her species from extinction…
A: Since you have asked a question with multiple subparts, we will answer only first three subparts for…
Q: What is a polyp?
A: In the normal cell cycle, the cell undergoes controlled division, differentiation, and…
Q: Following on from the last question, what assays could you do to find out if your mitochondria are…
A: Succinate dehydrogenase is an essential enzyme that connects oxidative phosphorylation and the…
Q: Which of the following metabolic pathways is correctly matched with the key enzyme that regulates…
A: A regulatory enzyme is an enzyme in a biochemical pathway which, due to its ability to respond to…
Q: Which of the following enzymes is NOT operating during glycogenolysis? a. glycogen phosphatase b.…
A: The normal response for the breakdown of glycogen to glucose-1-phosphate is: glycogen(n residues) +…
Q: 2. (a) Both myoglobin and haemoglobin bind oxygen. If muscle did not contain myoglobin, what would…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: What test can be performed to identify this lipid structure?
A: A group of organic compounds includes lipids that are insoluble or poorly soluble in water.…
Q: Which enzyme activity of the glycogen debranching enzyme is operating during the release of glucose…
A: Enzyme are proteins or catalyst that help to speed up metabolism or chemical reaction in our body…
Q: Draw the structure of the a-keto acid formed by the transamination of each amino acid: (a) tyrosine…
A: Transamination can be described as the reaction of removal of α-amino nitrogen of amino acids by a…
Q: The following is a part of the sequence on DNA template strand. 5' ATGGCCCGGTAAGTA 3' Write the…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: You have been provided with the results of a sequence analysis of the gene for a fish with a small…
A: Chromatograms are depicted in colourful peaks which are used to represent the sequence of bases in…
Q: You have been hired to produce a family tree for three generations of a family where a disorder…
A: Introduction: A pedigree is a diagram that shows the genotypes and phenotypes of organisms from one…
Q: Which description is true regarding beeswax
A: cera alba which is chemical name of beewax is a natural wax which is produced by honey bees. The…
Q: 4. a. A polypeptide contains 36 amino acids. How many nucleotides should be found in the open…
A: Codons are triplets of nucleotides, which codes for specific amino acids. The open reading frame is…
Q: ACTIVITY 8.1.3 Complete the table Name and Structure of the attached molecule Sphingolipid Function…
A: Introduction: Sphingolipids are complex lipids that make up the second-largest class of…
Q: Which of the following is NOT a signal molecule? А. САМР В. GABA C. Insulin D. Glucagon E.…
A: Signal molecules are also known as ligand. Ligand binds with receptors and starts signaling Cascade.
Q: Glycolysis is regulated primarily by _______________. a. three strongly exergonic, non-equilibrium…
A: The pathway that transform glucose to pyruvic acid is known as glycolysis. The free energy that is…
Q: 14. Paracrine signaling is characterized by ligands that are A. produced by the target cells…
A: Paracrine signaling is a type of cell signaling in which the signals are released into the…
Q: Question 40 A series of chemical reactions convert a polypeptide into 8 acetyl CoAs. This acetyl CoA…
A: 80 molecules of ATP are produced from 8 acetyl CoA. there is no standard units because this is a…
Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…
A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- • Kornberg and his colleagues incubated soluble extracts of E. coli with a mixture of dATP, dTTP, dGTP, and dCTP, all labeled with 32P in the α-phosphate group. After a time, the incubation mixture was treated with trichloroacetic acid, which precipitates the DNA but not the nucleotide precursors. The precipitate was collected, and the extent of precursor incorporation into DNA was determined from the amount of radioactivity present in the precipitate.a. If any one of the four nucleotide precursors were omitted from the incubation mixture, would radioactivity be found in the precipitate? Explain.b. Would 32P be incorporated into the DNA if only dTTP were labeled? Explain.c. Would radioactivity be found in the precipitate if 32P labeled the or phosphate rather than the phosphate of the deoxyribonucleotides? Explain.• Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGcoGOTTGACTOCTACCTTcccaGGATaccCAAAArTCTOGAG-3 +3-GATOGACOCCAACTGACGATGGAMGCCCTACOOUTITTAAGGCTC-S'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is happening at each step. temprature (2) eyntee. Why do we need to amplify the DNA at all in order to visualize it in a gel? Why run PCR? . • Why do we need to include a search for the piece of DNA that codes for Tubulin if we are really only interested in finding, in this case, a commonly used GMO sequence? When we run that gel, we also run a ladder...why? What information does that give us? Why does it form a ladder shape on the gel (what is happening to cause things to separate out into many bands)? .
- Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the species of the following DNA sequence: AACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAA Gene: DNA Polymerase II. Species: Mus Musculus Gene: RNA Polymerase I. Species: Homo Sapiens Gene: Insulin Receptor (INSR). Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR). Species: Homo SapiensThe following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). at of Koni Sall Eo R Pat Bam H Xhot Bem H Pat E Kon 100 200 300 400 s00 s00 700 00 00 1000 1100 1200 1300 1400 1600 1800 1700 1800 100 2000 The gel below shows: • a DNA ladder with markers every 200 bp (DNA Ladder) the resulting restriction fragments of the above DNA fragment if it was completely digested with the restriction endonuclease Xho I (Xho I Digest) the resulting restriction fragments of the above DNA fragment completely digested with unidentified restriction endonuclease(s) (lanes A through F) Which lane shows the DNA fragment completely digested with Pst ? Xho Digest Lanes DNA Ladder A. D F 2000 bp 1800 bp 1600 bp 1400 bp 1200 bp 1000 bp 800 bp 600 bp 400 bp 200 bp ||Protein Synthesis and Mutation Practice • Complete the lines below by determining the mRNA transcript and amino acid sequence. • Compare the mutant DNA strands to the wild type strand. ⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift - insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will be used in this assignment! Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:
- Gel electrophoresis can be used for all of the following purposes except A) Determining the function of a gene product B Separating DNA (c) Assisting with constructing a restriction map (D) Determining the size of a DNA fragment• Describe one effect of a Cas (CRISPR-Associated) protein on DNA molecules. How were we able to detect if the CRISPR-Cas9 experiment performed on butterflies was successful? Why did many bacteria acquire CRISPR-Cas systems in the process of evolution?(b) Use a drawing to illustrate the principle of DNA gel electrophoresis. +
- HELP EMAIL 19 The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). Sall Eoo R P Bam Xhe Bam Ee R Kan 100 200 300 400 s00 s00 800 00 1000 1100 1200 1300 1400 1600 1600 1700 100 1000 2000 700 The gel below shows: • a DNA ladder with markers every 200 bp (DNA Ladder) • the resulting restriction fragments of the above DNA fragment if it was completely digested with the restriction endonuclease Xho / (Xho I Digest) • the resulting restriction fragments of the above DNA fragment completely digested with unidentified restriction endonuclease(s) (lanes A through F) Which two restriction enzymes where used to completely digest the DNA fragment above based on the results shown in Lane C of the gel below? Choose two restriction endonucleases below. Both answers need to be correct to get the full mark for this question. Lanes DNA Ladder Xho Digest A B. D.…- Explain how you were able to identify plasmid in each sample using the gel, considering how linear DNA fragments of different length are separated by agarose gel electrophoresis.- Why do supercoiled, nicked and linear DNA sequences of the same size (kb) migrate at different rates during agarose gel electrophoresis?- How does SYBR Safe® enable the visualisation of the location of DNA fragments on the gel?Home Work: • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5' -СТАССТСCGGGTTGACTGСТАССТТССССGGATGCCCAAAAТТСТСGAG-3— :::::::::::: :::::::::::: :::: +3'-GATGGACССССААСТGACGATGGAAGGGCCCТАССGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is happening at each step. (1) température cycle #1