HUAWEI Nova 2 PlusDUAL CAMERAReal-time PCR is used in many applications, in which of the following applications you need the step of reversetranscription?Select one or more:O a.Gene transcription quantificationOb. in DNA genotypingOC. Any time we run a Real-time PCRO d. When amplifying a gene of interestO e.In gene copy number detectionThe non-nucleoside inhibitors are supposed to be a better choice to treat hypermethylated genomes because:O a. They bind and interfere with the methylating enzyme.O b. They can convert cytosine into thymine.Oc. They can convert thymine into cytosine.O d. They can bind to the promoter region and prevent methylation.e. They can convert the methylated cytosine into thymine.80NEXT PAGE

Note- According to the guidelines only one question can be answered at a time. Hence, the first…

Real-time PCR is used in many transcription? Select one or more: O a. Gene transcription qu b. Ob. in DNA genotyping OC. Any time we run a Re O d. When amplifying a ge O e. In gene copy number The non-nucleoside inhibitors O a. They bind and interfe O b. They can convert cytc O C. They can convert thym O d. They can bind to the p O e. They can convert the

Real-time PCR is used in many transcription? Select one or more: O a. Gene transcription qu b. Ob. in DNA genotyping OC. Any time we run a Re O d. When amplifying a ge O e. In gene copy number The non-nucleoside inhibitors O a. They bind and interfe O b. They can convert cytc O C. They can convert thym O d. They can bind to the p O e. They can convert the

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

Real-time PCR is used in many applications, in which of the following applications you need the step of reverse transcription? Select one or more: Oa. Gene transcription quantification O b. Ingene copy number detection O c. in DNA genotyping O d. When amplifying a gene of interest O e. Any time we run a Real-time PCR
O e. Gene amplification CLEAR MY CHOICE To study the function of any gene of interest you would perform the loss and gain of function approaches by either deleting or re-expressing the gene of interest, which of the following can be used to determine and quantify the activity of the gene? Oa. Western blotting O b. Gene knockdown O. PCR/OLA O d. Microscopy O e. DNA hybridization Paternity testing can be detected most precisely by using technique
OO HUAWEI Nova 2 Plus DUAL CAMERA estion To study the function of any gene of interest you would perform the loss and gain of function approaches by either deleting or re-expressing the gene of interest, which of the following can be used to determine and quantify the activity of the gene? red Oa. Microscopy d out of O b. Western blotting O C. PCR/OLA on O d. Gene knockdown O e. DNA hybridization stion Which one of the following is NOT correct regarding Bacterial Biosensors? O a. produced by all Pseudomonas species ed O b. Encoded by LacZ gene out of O c. Encoded by Lux genes O d. Chemical compounds used for the quantitative assessment of water pollution O e. In the presence of pollutants the bioluminescent decreases. stion CD4-Pseudomonas Exotoxin Fusion Protein is another biotechnology strategy for HIV therapeutic setting. This construct will target and kill: Select one: d O a. Any lymphocyte put of O b. HIV (virus only) O C. Non infected TH O d. Infected TH cells O e. Infected TH…
Synthesis of hybrid genes can occur by Directed mutagenesis O Using overlap primers O RT-PCR O Inverse PCR
PCR Analysis la: The 2x PCR Master mix has four main components. Two of these are PCR Buffer and MgCl2. Based on your knowledge of DNA replication and PCR, what are the other two components and what are their functions? 1b: Explain what would happen if the PCR reaction did not contain Taq polymerase? Assuming all other required PCR components are present, would any part of the PCR reaction occur? Explain your reasoning. 1c: Why does a PCR reaction require a primer? Would you expect this primer to be composed of DNA or RNA? Explain your reasoning. 1d: Should PCR primers be complementary to each other? Explain your reasoning le: As you know, experiments include controls. In this lab, a negative control was included along with your experimental samples. Which components do you think the negative control would contain? Hint: Think about which component would be left out of the negative control relative to the experimental samples. Explain why. 1f: What would the PCR product be for the…
Select all that apply: Which of these components must be added to a PCR reaction for it to produce a product?O DNA PrimersO Buffers- dNTPsO RNA PrimersO NTPSO PrimaseO Template DNAO Taq DNA Polymerase
(i) (ii) What is the major difference between the conventional PCR and real time PCR (qPCR) in terms of function? SyBR green and Taqman dyes are usually utilized in real time PCR. Which dye is more sensitive and accurate? Explain your answer.
For this activity you will draw out the first steps of the PCR reaction, using the following as a short template. Take a picture of your drawing and upload it to this Question. 5' TTGCGTACGTGCATGTGTGCACATATGTCC 3' 3' AACGCATGCACGTACACACGTGTATACAGG 5° In your upload submission be sure to include: 1. Label the 5' and 3' end of the template and each primer, and indicate the direction in which polymerization will take place. 2. Write the sequence of a 10 base pair Forward primer and a 10 base pair Reverse primer binding to the template strand. Add an arrow showing which direction polymerization will take place 3. Add a DNA polymerase to the drawing above showing where the polymerase will bind. 3. Draw and label a DNTP nucleotide. Show how this monomer gets incorporated into a new DNA strand?
PCR is quick, efficient and easy to perform. However, there are some situations when cell-based cloning is preferred over PCR to amplify a DNA sequence. Mention two of them.
1. Explain what primers are and what purpose they serve in a PCR reaction. Explain the main steps and temperatures of one PCR cycle. 2. Explain the purposes of the following components of gel electrophoresis: agarose, loading buffer, DNA ladder/marker, electrode buffer, electrodes. 3. Explain the expected results of the Alu sequence at PV92 that we tested, in terms of numbers of bands and their sizes. A labeled drawing would suffice.
Explain how the percentage efficiency of a real-time PCR reaction is determined using a theoretical experiment and why this is essential in any real-time PCR analysis.
1. You decide to perform dideoxy sequencing on a PCR product. You add the appropriate 32P- labeled primer, DNA polymerase, DNA template (the PCR product), buffer, DNTP mix, and a small amount of one of the four ddNTPs to four reaction tubes. You run the reactions in the thermal cycler, load each reaction into a separate lane of a polyacrylamide gel, and separate the products by gel electrophoresis. In the figure below, the lanes are labeled according to the ddNTP added. ddATP ddTTP ddCTP ddGTP - Lane 1 2 3 4 a) In lane 5, draw what you would expect to see if you prepared a reaction using a nucleotide mix containing only DATP, DTTP, dCIP, and dGTP. b) In lane 6, draw what you would expect to see if you prepared a reaction using a nucleotide mix containing only ddATP, DTTP, dCIP, dGTP. ||