Q: 2. On a sunny day, you enter a dimly lit room and see an apple. At first, the apple looks like the…
A: ANSWER) The illumination of the objects is determined by the diameter of the pupil, larger the…
Q: Given a chance to become a bioentrepreneur, which of the plant products will you be able to place in…
A: The question is about a hypothetical scenario in which a person has the opportunity to become a…
Q: D. The is the order of the amino acids held together by peptide bonds which arise from condensation…
A: Proteins are made up of chemical compounds called amino acids. Proteins and amino acids are the…
Q: Some birds with shorter beaks enter into a population of birds with much longer beaks, resulting in…
A: According to the question, the microevolutionary process occur in this is an adaptive radiation.…
Q: 1. A drug is ordered at 3.5 mg STAT IM. Available vial is labeled 5mg/mL. What volume would be…
A: Drug is a chemical substance which is used by people for getting pleasant feelings. If a chemical…
Q: What_t_-SNARE protein changes from a _trans_ to a _cis_ state to facilitate the transformation of a…
A: The process of neurotransmitter release from a neuron involves the fusion of a vesicle containing…
Q: We know that there are several risk factors for cancer, which of those risk factors are significant…
A: Cancer results from the uncontrolled cell division. Sometimes during cell division when the…
Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…
A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…
Q: In the discussion box below, list your answer to the question and justify your answer. Also describe…
A: This question is about the behavior of lactic acid bacteria in different solutions. Lactic acid…
Q: Determine the population size of beluga in Canada. Explains with which sample scientific researchers…
A: introduction: The term "canary of the sea" refers to the white hue and variety of vocalisations of…
Q: What are the major benefits and the disadvantages of a rumen system? How does a cecal animal compare…
A: Rumen system is the ruminant digestive system. Ruminants are those who eat plants- herbivorous…
Q: Talk about the concepts of gene number, organismal complexity, and the C-value paradox. Give…
A: The concepts of gene number, organismal complexity, and the C-value paradox are all related to the…
Q: what might happen to a cell that was damaged by UV light and that has E2 inside the cell
A: UV ray is a radiation that is a form of non ionizing radiation . Which emitted by the sun. It use to…
Q: HO ↑ A CH3 B choline head group H3C. C glycerol backbone CH3 CH3 < CH3 B- CH3- CH3 C-CH₂-CH O O C 0…
A: A= Sterol group B= Choline C = Glycerol D = Acyl chain
Q: Fill in the blank with the most appropriate response: Regardless of discipline, __________ is…
A: Regardless of discipline testing hypotheses is central to all modes of scientific inquiry
Q: What type of bond occurs when electrons are transferred between atoms? hydrogen bonds double bonds…
A: ANSWER) Covalent bonds- The bonds formed between the atoms when the participating atoms share equal…
Q: You isolate ten new mutant yeast strains that are defective in synthesis of leucine, an amino acid.…
A: In this scenario, you have isolated ten new mutant yeast strains that are defective in the synthesis…
Q: 3. Why is rubisco considered to be the most important enzyme on earth? What does it do?
A: Introduction:- Ribulose-1,5-bisphosphate carboxylase/oxygenase, commonly known as rubisco is an…
Q: 3. When Mendel cross-fertilised tall purple-flowered pea plants with short white-flowered pea pla…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: one potential treatment for addiction is to inhibit the expression of the gene that codes for the…
A: Addiction is a complex condition that is characterized by compulsive drug-seeking behavior and drug…
Q: 5. Which of the following is considered acellular? Aspergillus fumigatus Mycobacterium tuberculosis…
A: Introduction: All three types of viroids— viruses, virions—are examples of non-cellular life.…
Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…
A: In transcription, the template strand is the strand of DNA that serves as the template for the…
Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…
A: The research contributes to a better knowledge of illnesses and other health issues, such as their…
Q: Direction: Read and analyze the following laboratory experiment and answer the following question.…
A: By studying cells in the laboratory, scientists can better understand the underlying processes that…
Q: Explain how the temperature of the human body is regulated
A: Maintaining constant bodily conditions is part of homeostasis. The stability of the environment is…
Q: Compare and contrast diabetes mellitus and diabetes insipidus.
A: Diabetes is a chronic disease that lasts for a long period of time and is typically characterized by…
Q: What is the difference between quantitative and qualitative analysis? Give several examples. Define…
A: Quantitative analysis : Quantitative analysis is expressed in numbers and graphs. It is used to test…
Q: The physician has ordered acetaminophen every 6 hours for a child weighing 10 lbs. The…
A: Recommended low dosage of acetaminophen= 200mg/kg/24hrs Weight of the child= 10lbs= 4.5kg
Q: Which of the following is generally true about eukaryotic gene regulatory regions? a. All regulatory…
A: Genes are the segments of DNA that code for polypeptide chains. The expression of the genes in…
Q: How does pollination take place in water hyacinth and water lily
A: Pollination: The process of transfer of the pollen grains from the anther which is the male…
Q: You have consumed a six-pack of beer in the course of an evening. The intake of alcohol can decrease…
A: Hormones are chemical signals that are directly secreted into the blood, where they are transported…
Q: What are the genotype and phenotype ratios of potential offspring when a man with type AB blood…
A: Blood groupings are inherited. They follow a Mendelian pattern, which means they are the result of a…
Q: Problem #4 In cattle, coat color is controlled by two codominant alleles. One allele produces a red…
A: Example 1 shows the dihybrid cross where two characters are involved. Homozygous condition is always…
Q: Why are petri dishes ALWAYS stored and incubated upside down? Question 17 options: a) helps…
A: ANSWER) Petri dish is a transparent dish which is shallow and is used with the purpose of holding…
Q: 5. Why is this decision such a struggle for Suzanne and David? Explain how the implications noted at…
A: Alzheimer's disease is a progressive brain disorder that affects memory, thinking, and behavior. It…
Q: What are the various methods that might be used to inactivate or eliminate chlorine-resistant…
A: Water treatment plants usually used conventional methods to purify the water such as filtration…
Q: Is glucose into the cell facilitated diffusion or active transport
A: Glucose cannot diffuse directly into cells but enters by a transport mechanisms: Na+ -independent,…
Q: abbreviated name
A:
Q: 2 Please draw the arrow-pushing mechanism to create the polyketide backbone chain of TYLOSIN. If two…
A: The arrow-pushing mechanism is a type of drawing or method in which the arrow moves from the…
Q: Where in the human body would you find mucous membranes? Question 20 options: a) rectum b)…
A: Introduction The mucous membrane, which protects the surface of internal organs such as the…
Q: 1. All organisms use similar energy-carrying molecules which shows the "grand unity of life". Name 2…
A: The universal 2 energy carrying molecules are ATP and NADH or in case of plants NADPH.
Q: O Lipid Functional protein Nucleotide Polysaccharide Monosaccharide Polymer Tertiary (protein)…
A: Five images labeled A, B, C, D and E are given and we have to assign these images to the given list…
Q: Primary Secondary Tertiary Quaternary Sequence of amino acids. + ✓ [Choose ] Sequence of amino…
A: Proteins are sequence of amino acids that are joined by means of peptide bonds. The structure and…
Q: 19. In the leaves of most plants, where can chloroplasts be found? a. b. C. d. in the upper…
A: A membrane-bound organelle called a plastid, or chloroplast, is a type that primarily facilitates…
Q: How is it possible for aphids to feed only on the carbohydrate-rich but nutrient-poor sap of phloem…
A: Microbiology: The science of micro creatures' biology includes viruses, bacteria, algae, fungus,…
Q: What about the references?
A: If we see around us there so much there to explore and learn. Science allows us to understand things…
Q: estions 1-2: Describe an appropriate control for each of the following. An investigator studies the…
A: In an experiment control is used when the independent variable is removed or set at standard value.…
Q: We measure species density in plant ecosystems, When random sampling and systematic sampling…
A: Random sampling :- Random sampling is a type of the sampling technique in which each sample has an…
Q: Respiratory droplets, vomiting, diarrhea, sexual fluids and pus from skin lesions are examples of…
A: a. Portals of exit.
Q: This is for an immunology class 1. Name of a type of host defense mechanism 2. One of the types…
A: Introduction: Immune system: an intricate system of organs, tissues, and the substances they produce…
draw the p21 promoter in a cell without E2F
Step by step
Solved in 3 steps with 1 images
- Expression of S-phase genes is activated when O P16 inactive or absent P16 active Cdk4 inactive O Active Rb bind with E2FDescribe the effects of the mutation causing the p21 promoter to no longer bind p53 on cell signaling pathways and metabolism or cell cycle control.Which of the following small GTP-binding proteins does NOT play a role in cell migration during chemotaxis? O Cap Z Rho Cdc42 O All of the listed GTPases play a role in cell migration O Rac ◆ Previous
- e B 1_30*_SP23 - General Biology I (for majors)/11364 of € 2 A us page X F1 What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan within the cytoplasm? Select one: a. lactose would attach to the repressor removing it from the promoter promoting the transcription of lactase b. no repressor is on the promoter creating constant transcription of lactase c. tryptophan would attach to the repressor removing it from the promoter promoting the transcription of lactase O d. repressors would bind to the promoter stopping the transcription of lactase e. lactose would attach to the repressor removing it from the promoter promoting the transcription of tryptophan producing enzymes no repressor is on the promoter creating constant transcription of tryptophan producing enzymes tryptophan would attach to the repressor binding it to the promoter and stopping the transcription of tryptophan producing enzymes O f. O g. 2 Oh. tryptophan would attach to the…Describe the ATM-p53 repair pathway in normal cells and cancerous cellsChromosomal translocation can result in cells expressing a fusion protein with uncontrolled receptor tyrosine kinase activity due to inability to respond to growth factor ligamds . An example of this type of fusion is: Fos/Jun ErbB/Ras Tel/PDGFR Myc/Max
- Describe the nature of p53 reactivation as acancer-fighting strategyWhat is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°
- Can you please help me by drawing a serie of schematic figures that demonstrates the information in the paragraph below? In addition to phosphorylation, the C-terminal domain of p53 can also be acetylated and sumolated in response to DNA damage. Acetylation and sumolation both result in an increase in the transactivation ability of p53 and may account for this finding. In vivo, IR induces the acetylation of p53 at Lys320 by PCAF and Lys382 by CBP/p300. Acetylation at these sites is dependent on N-terminal phosphorylation at Ser15 and to a lesser extent on phosphorylation at Ser6, Ser9, and Thr18 (Saito et al., 2002; Wahl and Carr, 2001). All of these phosphorylation events are ATM-dependent, although only Ser15 has been shown to be phosphorylated directly by ATM. Sumolation occurs at Lys386 after DNA damage (Muller et al., 2000). Sumolation refers to the covalent attachment of a small ubiquitin-like molecule (SUMO-1) to Lys residues, but in contrast to ubiquitination, does not result…True or False? p21 inhibits the S-cyclin/S-Cdk complex.In tumor cells obtained from patients with Burkittlymphoma, a cancer of the immune system’s B cells,the myc gene often appears close to one of the breakpoints of a reciprocal translocation between chromosomes 8 and 14. In this translocated position, myc is expressed at a higher-than-normal level. Scientists hypothesize that Myc protein overexpression in B cellscontributes to lymphoma formation.a. Explain how transgenic mice produced using pronuclear injection could be used to test this hypothesis. (Assume that you previously cloned a generegulatory region that is active specifically in Bcells throughout the life of the mouse.)b. Suppose you wanted to overexpress Myc only inthe immune cells of mice, starting at one week ofage. To restrict Myc transcription spatially, youwill use same promoter described in part (a). Torestrict Myc transcription temporally, you will usea cre transgene whose expression is controlled byheat shock (hs-cre). Describe the mouse you wouldcreate to accomplish…
