5. Why is this decision such a struggle for Suzanne and David? Explain how the implications noted at the end of Part I could impact the lives of Suzanne and her family.

QUESTION 5 Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is highlighted in blue. Transcription begins 10 bases from the promoter. The C marked with a heart is replaced by a A. What kind of mutaiton is this? 5'-ATATTTGCTAGACTGTCGCTCCGATCTGTACTTGATGCGATTČGGATCCCCGCTCCGATCGTAGGAGATTGCTGTTTTAC-3' 3'-TATAAACGATCTGACAGCGAGGCTAGACATGAACTACGCTAAGCCTAGGGGCGAGGCTAGCATCCTCTAACGACAAAATG -5' Promoter Terminator Silent O Missense O Nonsense O Frameshift

Question 38 Plant cells carry out photosynthesis to produce all of their ATP whereas animal cells carry out cellular respiration to produce all of their ATP. O True O False MacBook Pro esc 吕口 DII F1 F2 F3 F 4 F5 F6 F7 F8 1 3 4 Q W Y А F J ck Z C V 00 T %24

Question 27 Histone H1 O is part of the core particle O represses transcription both a andb none of the above A Moving to another question will save this response. MacE OO O

Question 5 Translocation O occurs before peptide bond formation O moves the RNA four bases moves the RNA three bases. O none of the above A Moving to another question will save this response. MacBook Pro

QUESTION 10 Remdesivir is     converted in vivo to CMP analog and then phosphorylated to CTP analog.     a successful treatment for Ebola.     There are more than 1 correct answers in the other choices.     a potential chain terminator for the replication of RNA viral genome

Question 36 Most eukaryotic RNA consists of coding regions, called and noncoding regions, called A introns; codons B introns; exons (c) codons; spliceons (D exons; introns

Question 30 Nematodes (roundworms) O Are found in the soil O Are parasites of virtually every multicellular animal and plant Shed a non-stretchy cuticle in order to grow O All of the above O Lack (do not have) a specialized system for the absorption or delivery of oxygen

Question 6 While using an electron micrograph, you see very small hexagonal shapes bursting out of a bacterial cell. What is the most specific category/classification that you can assign to these shapes? viroid amoeba eukaryotic cell virus prokaryotic cell

Question 29 PCR is a technique that:     produces information regarding the sequence of nitrogenous bases     virtually eliminates operator error from DNA analysis     All of these     can produce many exact copies of segments of DNA     provides a statistical analysis of the nitrogenous-base pairings