What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following sequence ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3

In eukaryotes, transcription factor activators bind to their enhancer elements and interact with RNA polymerase only through mediators. O True O False

If p63 can bind to the same promoter elements as p53, why would it be considered an inhibitor of p53?  Can you clarify this relationship a bit?

You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. mRNA 20 ORI 40 60 3' GATATTACTGGI АAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАСЕССТАCGTGATAG TTCGAGCTCTCGTCGTCGAGATACGCGATGAT GGTAATATGGGATGCACTATC 5' promoter RNA polymerase Practice Question 4 E) You also study the expression of different mutants for this gene. Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position 30 (position denoted by the * in the sequence above). For mutant A answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5'…

Which of the following proteins is a combinatorial transcriptional regulator in Drosophila that affects the differentiation of multiple cell types? O the glucocorticoid receptor O MyoD O Ey O Muts O maintenance methyltransferase

True or false, if false please explain why

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.

Recently, scientists constructed a transgene that expresses a mutant form of Drosophila histone H3 inwhich lysine 27 in the histone tail was changed to methionine (H3K27M). Expression of the H3K27Mtransgene results in aberrant development of fruit fliesbecause of inappropriate expression of many differentgenes. Explain this finding.

Match the protein on the left with the type of activation of that protein on the right STAT Smad PKA Ras NFKB Nuclear receptor [Choose] [Choose] GTP binding serine phosphorylation Interaction with Galpha Cleavage by y-secretase destruction of a protein by proteasome tyrosine phosphorylation second messenger ligand binding [Choose] [Choose] [Choose]

You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGAТАТТАСТGGТААТАТСGGGАTGCAСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG promoter RNA polymerase Practice Question 4 A) Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? ribosome ||