Q: See below for an organism below that was grown in various pH and temperature conditions. Determine…
A: Optical density is describes about how much light is absorb by the material and how much light is…
Q: XAMPLE 2: The parents in the family above produce another son, this time with two Y chromosomes and…
A: The nondisjunction occurs in the father in which during the second meiotic division nondisjunction…
Q: The trans epithelial electrical resistance (TEER) is a characteristic property of an epithelium.…
A: Introduction In cell culture models of endothelium and epithelial monolayers,…
Q: fatty acid with one or more double bonds between carbon atoms: is unsaturated. has the maximum…
A: The answer is “Unsaturated”. A fatty acid with one or more double bonds between carbon atoms is…
Q: The enzymes of the citric acid cycle are located in the a. Inter membrane space of mitochondria…
A: The citric acid cycle is an important metabolic route that links the metabolism of proteins, fats,…
Q: 34. A dermatologic lotion contains 1.25 mL of liquefied phenol in 500 mL. Calculate the percentage…
A: Dermatologic solution is used to treat skin infection. It is applied on the skin, nails etc.
Q: From my point o veiw, this anwer is either A, B, C, D, or E, so where is the answer?
A: An evolutionarily conserved mechanism that is essential for preserving cellular homeostasis is the…
Q: Q6.10. For a population containing 70 females and 30 males, what is the effective population size,…
A: Evolution is a steady phenomenon that cause transformation of life form from much simple to more…
Q: Indentify the correct food web for each question. Which type of food web cycles materials and moves…
A: INTRODUCTION Food chain : it explains who eats whome in a wild. This helps to the flow of energy and…
Q: What does maximum assimilation (amax) tell us about the plants photosynthetic rate?
A: Photosynthesis is the process by which plant convert the light energy from the sun to the chemical…
Q: 3d bioprinting systems, biomaterials, tissue engineering. Indicate 3 creative project topics on the…
A: 3d bioprinting : The process that utilizes the living cells along with the biomaterial to produce…
Q: 25. ATROVENT Nasal Spray contains 0.03% of ipratropium bromide in a 30-mL me- tered dose container.…
A: Atrovent (ipratropium) is a medication used to help control mild chronic obstructive pulmonary…
Q: graduate student wants to isolate cells from a patient and grow them perpetually in culture to study…
A: The correct answers are as follows- A. Telomerase C. MDM2 A graduate student wants to isolate cells…
Q: Describe the methods used in the laboratory diagnosis of the following: a. syphilis b. relapsing…
A: Syphilis The most common way that syphilis is transmitted is through sexual interaction. Usually, on…
Q: Explain What are the advantages and disadvantages of CCL22, SERPINE1, TIMP1, CX3CL1 genes to…
A: There are a few important points : All genes whose genetic and epigenetic changes contribute to the…
Q: A substitution mutation that affects single nucleotide within the genome will result in a(n): CNV…
A: Introduction :- A single nucleotide can be replaced with a different nucleotide in a mutation called…
Q: Three mushroom-forming species are adapted to live in the desert. How are desert mushrooms adapted…
A: With the study of fungi, we would be able to know that Fungi play a critical role in the…
Q: 13. The process of "cell drinking" is called: a. phagocytosis b. exocytosis c. pinocytosis d.…
A: 13 . c. pinocytosis reason : Pinocytosis: In this procedure, the organisms consume the liquid. It's…
Q: Hydromorphone hydrochloride supposi- tories contain 3 mg of active ingredient and weigh…
A: 39. Given, hydromorphone hydrochloride suppositories contain : Active ingredient = 3mg, and Total…
Q: What are the 5 spaces of the infrahyoid neck and the contents of each?
A: We know that The infrahyoid neck is the area of the neck between the hyoid bone and the thoracic…
Q: What is different about prophase I and prophase II of meiosis?
A: Cell division is the process through which new daughter cells are formed from the parent cells. It…
Q: Purple (P) flower color is dominant to white (p) flower color. Cross two heterozygous parents using…
A: P allele encodes purple flower. It is dominant over p allele. The p allele encodes white flower.
Q: From the perspective of a bacterial cell, describe two ways in which a mutation can be harmful and…
A: Mutations are sudden changes that may occur in DNA sequences that may or may not cause the drastic…
Q: Please explain why cell division is needed and important?
A: Introduction: Cell division is a biological process during which a cell divides to produce…
Q: You are studying a population of 1000 skunks (which are diploid). You sample alleles at two genetic…
A: Given information There are 1000 skunks that are diploid. A gene has two alleles A and a which are…
Q: The chemical analysis of a saliva of the patient has revealed decrease of concentration of potassium…
A: Introduction Acini, which is a rounded secretory unit, and ducts make up salivary glands. Serous…
Q: Explain pulmonary embolism caused by Thrombus in terms of: predisposing factors incidence pulmonary…
A: ANSWER) In order to answer this question we need to understand the concept of Pulmonary Embolism.…
Q: Match the organelles on the figure with their functions. site of cellular respiration makes…
A: According to bartleby guidelines only the first three have been answered. Kindly post the remaining…
Q: A single glucose molecule can drive the citric acid cycle ...... one turn 2 turns 3 turns or 4…
A: Citric acid cycle is a sequence of chemical events that take place inside all the aerobic organisms…
Q: explain and proivde anylyses what are the diagnoses and current and potential future treatments for…
A: adenocarcinoma tumors colorectal cancer (colon) can be diagnosed by following tests 1. Blood test-…
Q: 1A. If Creb upregulates gene T with acetylcholine stimulation, what happens to T when cAMP…
A: All cells receive and respond to signals from their surroundings. This is acomplished by a variety…
Q: 9. Describe the respiratory structures use by onychophorans, spiders, horseshoe crabs, terrestrial…
A: Onchyphora: Any segmented, limbless, wormlike land invertebrate of the phylum Onychophora that…
Q: What are cry genes
A: Cry genes are genes that code for the Bt toxin protein. They are toxic to certain insect pests.…
Q: Gluten was isolated from beef muscle by isoelectric precipitation. TRUE OR FALSE?
A: INTRODUCTION: Grains like wheat, rye, spelt, and barley all include a class of proteins called…
Q: what are the downsides of homologous recombination, if there are any and how do cells replicate DNA…
A: A double-stranded DNA molecule is copied to create two identical DNA molecules through the process…
Q: Draw and label a 2n=4 cell going through anaphase of mitosis.
A: The process of nuclear division occurs when a parent cell divide and produce two identical daughter…
Q: OLIVE V 4 Type of immunity immunity is when enough individuals have acquired immunity and there are…
A: Introduction :- Immunity that you acquire over your lifetime is known as acquired immunity. A…
Q: @ Explain or describe how homeostasis is the mantenance of a dynamic range of environmental…
A: Homeostasis is the process in which the body changes adjusts to the change in the environmental…
Q: The parents in the family above produce another son, this time with two Y chromosomes and normal…
A: 1. We all know that for male progeny to occur in human is that it gets its X chromosome from his…
Q: Write short note on Tanh and ReLU neurons.
A: Neurons are the fundamental units of the brain and the nervous system, the cells responsible for…
Q: Contain the protein hemoglobin Function in immunity and fighting infections Transport oxygen and…
A: RED BLOOD CELLS- Hemoglobin is a protein found in red blood cells, sometimes referred to as…
Q: Which of the following types of interactions best describes the binding of MDH-His to the affinity…
A: f -The binding of MDH -His to the affinity of chromatography resin is through ionic interaction.
Q: A patient shows you a bottle of mouth rinse and asks you if it would be all right to use this mouth…
A: Basil sweet and peppermint are among the essential oils that can help with recovery. These oils can…
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: You are interested in testing whether fetuses, at 34-weeks gestation, can tell the difference…
A: The development of a human being necessitates the appropriate environment, the right circumstances,…
Q: 9. Creep is best described as the change in length of a tissue in response to a period of time. a.…
A: Creep is a time dependent deformation at constant stress and increased temperature.
Q: Why is it essential to balance your 400 mL of cell culture before centrifuging?
A: Ans: A centrifuge is a machine which use centrifugal force to separate the components of a mixture.…
Q: Explain the relevance of polymerase chain reaction (PCR) in clinical practice.
A: Introduction :- With the use of the widely utilised polymerase chain reaction, scientists may…
Q: howing statemen is/are only best answer. All three of the other statements are true. Genome…
A: Genome rearrangements can be caused by errors during Meiosis-True When a pair of homologous…
Q: Discuss the application of the following techniques in histopathology: 1.2.1. Immunohistochemistry…
A: Introduction Histopathology is the study of illness symptoms utilizing a microscopic examination of…
do hormones have gender
Step by step
Solved in 2 steps
- What is the difference between gender and sex? Is gender identity something that is genetic or it is shaped by culture and environment. How did the tragedy of the Reimer twins contribute to our understanding of gender identityAnswer all the questions thank you so muchWhat happens when you have sex everyday
