DNA sequences CGCCTAGTCA Strain 1 TCCCTACT CG Strain 2 ATCCTATAAC Strain 3. GACCTAAGCT Strain 4 Strain 2 = Strain 3 = 40 Strain 4 = 50 60 70 d Please use the above figure for the following question. If no figure appears, please use Figure 4. Fill in the blanks by writing the letter of the location where each of the strains belongs in the cladogram. Strain 1 = Percent Relatedness b

planet Reen in a distant solar system. They only have one chromosome with eight genes on it that determines the organism's appearance. Your job is to transcribe and translate the DNA and determine what traits the organism has and In this simulation, you will examine the DNA sequence of a fictitious organism. These organisms were discovered on the TAC CAT AGA TTT ATT TAC CAA GGA TGA GGT TTC ATC TÁC GAA GAG GAG GGG ATT TAC CAA CGC CGA ATT TÁC GTA GTG ATC TAC CAT AAA ATA ACT TAC TTA TAA GAA GAC GGG TGT ACT TAC TTA Protein Synthesis then sketch the organism TTA TTA CGT ATT TAC AAG AGC GTG ATT TAC TCC TCT TTA TGT ATT Amino Acid Sequence Genes Description Short and spiky hair Met - val - ser - leu Gene 1- body covering Met - val - ser - lys Long and curly hairy Met - tyr - pro - glu - pro - lys Gene 2 - body shape Met- val - pro - thr - pro - lys Round body Met - leu - leu - leu - pro Square body Gene 3 - # of legs Met - leu - leu - ser - ala 4 legged 2 legged Met-ala - val - val round head…

Most yeast grow suspended in culture, but some yeast grow as a film on the top of a liquid culture.  These are called flor yeast.   The following Southern blot is looking at the FLO11 gene that is thought to be involved in whether yeast are flor or not.  DNA was isolated from four different yeast strains.  Strains 1 and 3 are normal while strains 2 and 4 are flor (Fidalgo, 2006).  Based on the gene map and Southern results below, what aspect of FLO11 determines whether a strain will be flor or not?

Q1/ Choose the Right Answer 1. Biomaterials science is not significant monetarily, but the magnitude of the field is extremely important since biomaterials are used to save millions of lives. a) Ttrue , b) False

The following chromatogram is obtained from the sequencing reaction. Using the key below, what message did you integrate into the yeast genome? AATATTAAAGTATAGAACGACTGTGAA A B с D E F G H I AAA AAT AAG AAC ATT ATG ATC AGT AGG J K L M N O P Q R Key GGG GGA GGT GGC GAA GAC GAT GTT GTA S T U V W X Y Z (SPACE) TTT TTC TTA TTG TGT TGA TGG TAA TAG

There are 27 sequences from 27 individuals belonging to an unidentified group of organisms. Eleven (11) sequences were mined from NCBI while the rest are unpublished sequences from Mindanao. Sequences labeled with "SSL" are from Agusan Marsh while sequences labeled with "CKL/CITLR" and "CWL" are from Camiguin Island and Dinagat Islands respectively. Finally, sequences labeled with "MSLA" are from Mt. Magdiwata. From the nucleotide results and generated phylogenetic tree below: a) What group of organisms is represented by the phylogenetic tree? b) Identify the source (species) of each sequence. c) How many species are present in the generated tree? d) What species is considered as the outgroup? e) What genetic marker is utilized to generate the sequences? f) Which specimen group is more closely related to "SSL"? CKL or MSLA? Justify your answer h) Based on the results, what possible species name can be assigned to the MSLA group?

Which two species in this DNA sequence alignment are the most closely related? Explain your answer referring to specific nucleotide positions to justify the choice you made.

You have sequenced the genome of the bacteriumSalmonella typhimurium, and you are using BLAST analysis to identify similarities within the S. typhimuriumgenome to known proteins. You find a protein thatis 100 percent identical in the bacterium Escherichiacoli. When you compare nucleotide sequences of theS. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical.a. Explain this observation.b. What do these observations tell you about the meritsof nucleotide- versus protein-similarity searches inidentifying related genes?

L A Moving to another question will save this response. Question 3 Which is the correct sorting from the largest to the smallest? Triplet; genome; chromosome; gene; nucleotide; phosphate group; phosphorous atom Genome; chromosome; gene; triplet; nucleotide; phospahate group; phosphorous atom Triplet; genome; chromosome; nucleotide; gene; phosphate group; phosphorous atom Genome; gene; chromosome; nucleotide; triplet; phosphorous atom; phosphate group

what analysis can be gathered from the raw count section and also what can also be said for the whole data as a whole. 500 in total please