
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
DNA polymerase III adds
to both ends of the RNA primer |
||
to the 5' end of the RNA primer |
||
to the 3' end of the RNA primer |
||
in the place of the primer RNA after it is removed |
||
to internal sites in the DNA template |
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 7 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- -Nucleotide added on template -Nucleotide added on new strand -RNA primer removed -RNA primer extended -Nucleotide removed on new strand -Nucleotide removed from template Which one?arrow_forwardMatcharrow_forwardDNA replication is considered semiconservative because _______. Select one: it will create a new identical strand to the template. it can replicate from two directions (bidirectional) from the origin(s). it uses one old strand as a template for the synthesis of a new strand. it always replicates in the 5' to 3' direction.arrow_forward
- The epsilon subunit of DNA polymerase III is responsible for its _______ activity.A-5'---->3' polymerase B- Sliding clampC-3'----->5' exonuclease activity D-5'------>3' exonuclease activityarrow_forwardדוידודוודי www.www. The above image shows DNA during replication. The new DNA strand build using the top strand as the template would be considered ( Select ] v strand, whereas the new DNA strand build using the bottom strand as the template would be considered ( Select) strand. The lagging strand is synthesized discontinuously and is made up of small fragments called [Select ] v fragments. These fragments contain RNA primers synthesized by [ Select ) ( Select) replaces RNA in the primers with DNA and [ Select ] v glues the fragments together to form a continuous strand. inarrow_forwardDNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer to the 3' end of the RNA primer in the place of the primer RNA after it is removed to internal sites in the DNA templatearrow_forward
- There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATCGG AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),arrow_forwardThe bacterial primase enzyme synthesizes _______________________. a short DNA primer using RNA as a template a short protein primer using RNA as a template an RNA strand in absence of template DNA a short DNA primer using DNA as a template a short RNA primer using DNA as a templatearrow_forwardThe type of DNA replication error illustrated in the diagram below is _______________________.arrow_forward
- 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’>3’ direction.arrow_forwardReplicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC. Translate your answer to #16 using the table below. Second letter A G UGU cys UGC UUU PheUCU UCC UCA UCG UAU1 UUC UUA UAC J Tyr Ser UAA Stop UGA Stop A UAG Stop UGG Trp G UUGLEU CAUTHIS CÁC CUU CUC CUA CUG CCU] CCC CCA CCG CGU] CGC Arg Leu Pro CAA GIn CGA CGG. CAGS ACU ACC ACA AAC FAsn AAA AGU Ser AGC AGA LArg Lys AGGJ AUU AAU AUC le A AUA The AUG Mer ACG AAGJ GAU ASP GACJ GUU GCU GCC GCA GCG GGU GGC Gly GUC Val GUA Ala GAAG Glu GAGJ GGA GUG GGG Third letter DUAG JCAG DUAG C. First letterarrow_forwardPolymerase movement RNA POLYMERASE -Nucleotide being added to the vijend of the RNA RNA NTPS RNA-DNA hybrid region 32. Refer to the transcription bubble diagram (above) to fill in the blanks. 5'- 3'- Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA rewindingarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education