Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be?
Q: What are the known exceptions to the genetic code?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What are eukaryotic translation initiation factors (eIFs)
A: Answer- Translation is the process of formation of polypeptide from the mRNA sequence.
Q: When an intron is undergoing the first step in splicing, where is the first breakage of the…
A: Gene splicing is a post translational process, which is a characteristic of eukaryotes and it…
Q: Explain why alternative splicing increases the coding capacity of the genome
A: In the process of splicing, mature mRNA is formed due to the removal of introns, after they are…
Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…
A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…
Q: What are polycistronic mRNAs?
A: Transcription refers to the process of synthesizing the RNA from the template of DNA…
Q: Assume alternative splicing can generate all permutations and combinations. How many proteins…
A: Alternative splicing: The type of splicing that directs the mRNA to promote the synthesis of…
Q: explain importances in Splicing mechanism GU and AG sites branch point adenine U1, U2, U4, U5, U6…
A: In eukaryotes premature mRNA is produced by transcription process within the nucleus. Then this mRNA…
Q: a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…
A: C<-> A, G G<-> C,T CGG transversion are the following 1 ACC 2 ACT ЗАТТ 4 ATC…
Q: Assuming alternative splicing can generate all permutations and combinations. How many proteins…
A: Eukaryotes undergo ways of RNA processing after translation i.e. formation of mRNA from their DNA…
Q: A gene contains eight sites where alternativesplicing is possible. Assuming that the splicing…
A: according to the question, A gene contains eight sites where alternative splicing is possible:
Q: Why do Introns in a pre-operational transcript differ in size and number?
A: Introns An intron is any nucleotide sequence within a gene that is removed by RNA splicing to…
Q: recognition of the AUG initiation codon in an mRNA is TRUE?
A: In eukaryotes and Archaea, the start codon always codes for methionine, while in bacteria,…
Q: What is the mRNA for a Coding Strand of TAT?
A:
Q: You construct a translational reporter gene fusion of your favourite gene. How can you assess…
A: Translational Gene Fusion is employed to live protein localization by quantifying promoter activity.…
Q: What molecular biology strategy can best be used to determine Inhibition of the splicing of one…
A: In eukaryotic genes, introns exist. They are interstitial sequences (80-10,000 bp). They do not code…
Q: Transcription occurs at a rate of about 30 nucleotides per second. is it possible to calculate the…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. Using the…
A: Genetic codes are stored in the form of trinucleotide sequences (codons) in the mRNA.The mRNA gets…
Q: mutant appear on a gel in comparison
A: Point mutations can cause serious changes to an organism if they change the way a protein works By…
Q: For what silencing of mRNA has been used?
A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…
Q: Suppose that a 20-bp deletion occurs in the middle of exon 2 of the gene. What will be the likely…
A: Alternative processing and splicing results in the production of multiple mRNA and proteins from…
Q: Consider the CT/CGRP example of alternative splicing. Which different types of alternative splicing…
A: Alternative splicing is a technique that allows messenger RNA (mRNA) to control the production of…
Q: Assume alternative splicing can generate all permutations and combinations. How many proteins could…
A: Alternative splicing is a process that enables a messenger RNA (mRNA) to direct synthesis of…
Q: What structural change occurs in the DNA when an “open” transcription initiation complex is formed?
A: When an “open” transcription initiation complex is formed then this leads to the…
Q: Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What…
A: Unconstrained DNA sequence which are those sequences whose evolution is unaffected by selection are…
Q: How Can a Sequence Logo Be Used to Identify RibosomeBinding Sites on Bacterial mRNAs?
A: Introduction Bioinformatic is the advanced and recent branch of biology which utilizes computers…
Q: Results of dsx splicing when tra is present?
A: Splicing is the process of removal of non coding sequences called intron from the pre mRNA…
Q: How many different polypeptides can be producedthrough alternative splicing of the same pre-mRNA?
A: Maturation of eukaryotic mRNA often entails the removal of RNA sequences (introns or intervening…
Q: How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron…
A: Restriction digestion analysis of any band that is subjected to the process of reverse transcription…
Q: Assuming that each nucleotide is 0.34 nm long in mRNA, howmany triplet codes can simultaneously…
A: Nucleotide : It is an organic molecule that is the building block of DNA and RNA. They also have…
Q: explain which sequences within the pre-mRNA determine where splicing occurs? How? Why?
A: Splicing of a pre-mRNA molecule occurs in several steps that are catalyzed by small nuclear…
Q: Describe the effects of intron phase on alternative splicing with diagram
A: Alternative splicing involves the removal of introns from the mRNA transcript as introns are the…
Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…
A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…
Q: What is the function of the Shine–Dalgarno consensus sequence?
A: Prokaryotes are the organisms that lack the cell nucleus and membrane-bound organelles. They have…
Q: How the INS transcript find the smaller and larger Subunit in the cytoplasm to start the process of…
A: Ribosomes have two main components which are small and large ribosomal subunits. Each subunit of…
Q: What polypeptide product would you expect from apoly-G mRNA that is 30 nucleotides long?
A: Introduction:- The mRNA is composed of nucleotides .A series of 3 bases is a codon.Each codon codes…
Q: Explain why a minimum of 32 tRNAs are required to translate the “standard” genetic code.
A: Genetic code is considered degenerate, where several amino acids are encoded by more than just one…
Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene.…
A: A gene is the basic structural and functional unit of heredity. They are made up of DNA.
Q: Release Factors (RFs) that operate in translational termination are specialized TRNA molecules ,…
A: Release factors are the protein molecules that help in the termination of the translation process.…
Q: What is a polycistronic mRNA? How are polycistronic mRNAs formed?
A: Answer:Introduction: Polycistronic mRNA means messenger RNA means mRNA containing data for the…
Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…
A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.
Q: where is the transcript headed following transcription and why?
A: Ad per the central dogma, the genetic information that is present in the coded form (DNA) is…
Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…
A: Translation is the process of synthesis of protein from an mRNA. It requires two types of RNAs…
Q: Suppose the following are sequences at the 5' splice junction and the 3' splice junction, with…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: What is a frameshift error? Does the binding of methionine tRNA to the small subunit help reduce…
A: Answer: Introduction: Mutation- These are the random heritable changes that occurs in the DNA…
Q: What is meant by the term chromatin remodeling? Describe the importance of this process to…
A: Chromatin remodeling:It is the chromatin rearrangement from a condensed condition to a…
Q: Why do you expect that intron removal wouldreduce the delay?
A: Introns are defined as the DNA or RNA sequence that does not carry any information required for…
Q: Draw the SMN2 mature mRNA before treatment with Spinraza
A: To better understand let's revise that the DNA is the hereditary molecule that transfers genetic…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 4 images
- AUG Met ACG ANALYSIS ANALYSIS: A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template is given below: Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-СТT-CGT-3 DNA daughter strand: hnRNA: MRNA: original protein: mutated MRNA: mutated protein: second letter G UCU UUU Phe UAU Tyr UGU UGC Cys UAA stop UGA stop| A UAG stop UGG Trp UUC UCC UAC Ser Leu UCA UUG UUA UCG G CUU CCU CAU CGU His CAC CAA CUC C CGC Leu CUA Pro Arg A ССА CGA Gln CAG CUG CCG CGG AUU ACU AAU AUC lle A AUA AAC Asn AAA AGC AGA AGU Ser ACC Thr АСА AAG LyS GAU ASP AUG Met ACG AGG Arg G GUU GCU GGU) GUC GCC GAC GGC Val GUA GCA Ala GAA Gly GGA A Glu GUG GCG GAG GGG G Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be? The original protein is [A] (For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H). first letter third letterENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCESelect the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
- BONUS: Why can't RNA viruses use cellular RNA Polymerase to copy their genetic information? Because cellular RNA Polymerases are O RNA Dependent RNA Polymerase O RNA Dependent DNA Polymerase O DNA Dependent RNA Polymerase O DNA Dependent DNA Polymerase prt s homeMutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Complementary DNA sequence: mRNA sequence transcribed from template:Directions: 1. Use the DNA code to make a replicated copy of DNA. 2. Use the replicated DNA code to create your transcription mRNA code. 3. Use the mRNA code to create your tRNA anticodon. 4. USE THE MRNA CODE TO DETERMINE YOUR AMINO ACIDS. MAKE SURE TO PUT YOUR LETTERS IN ALL CAPS! DNA ATG GCA AGC GCT TGA DNA TAC REPLICATION DNA TO MRNA AUG TRANSCRIPTION MRNA to tRNA UAC ANTICODON MRNA to AMINO AUG (START) (STOP) ACID TRANSLATION DNA ATG ССА GAC ACG TGA DNA ТАС REPLICATION DNA TO MRNA AUG TRANSCRIPTION MRNA to TRNA UAC ANTICODON MRNA to AMINO AUG (START) (STOP) ACID TRANSLATION
- Match the DNA repair mechanism to the type of repair it fixes. Base excision repair DNA polymerase proofreading Non-homolgous end-joining Mismatch repair Nucleotide excision repair Double strand breaks Mismatches in S-phase Mismatches after S-phase, before M-phase Mismatches in interphase Thymidine Dimer Double strand breaks Mismatches in S-phase Mismatches after S-phase, before…DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Give the discussion of the entire procedureA. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
- BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letterFill in the blank spaces below with the most appropriate terms. The word bank is not provided. DNA replication in bacterium Escherichia coli begins at a site in the DNA called At the replication fork, the strand is synthesized continuously while the strand is synthesized discontinuously (in fragments). The new DNA strand, which is synthesized discontinuously, initially consists of short DNA pieces that are called A short RNA primer at the beginning of each of the DNA fragments is synthesized by an enzyme called and this RNA primer is later removed by the enzyme called using its activity. Single-strand breaks (nicks) that are left behind in this process are sealed by the enzyme called A Moving to another question w!l save this resporse Quebon 4 In