Fill in the blank spaces below with the most appropriate terms. The word bank is not provided. DNA replication in bacterium Escherichia coli begins at a site in the DNA called At the replication fork, the strand is synthesized continuously while the strand is synthesized discontinuously (in fragments). The new DNA strand, which is synthesized discontinuously, initially consists of short DNA pieces that are called A short RNA primer at the beginning of each of the DNA fragments is synthesized by an enzyme called and this RNA primer is later removed by the enzyme called using its activity. Single-strand breaks (nicks) that are left behind in this process are sealed by the enzyme called A Moving to another question wit save this resporse. Quesbon 4

Rank from the first to the last steps in DNA synthesis. Reset H DNA polymerase DNA strands separate as the enzyme helicase unwinds them DNA polymerase catalyzes the covalent addition of free nuclectides to the growing new DNA strands The enzyme primase builds ANA primers on the existing DNA strands Two identical doutle helices First Last

Hand written solutions are strictly prohibited.

Which of the following enzymes ensures that the correct base of a deoxynucleotide for growing the chain is aligned with template chain?   DNA gyrases   DNA ligases   DNA polymerases   primases

The type of DNA replication error illustrated in the diagram below is _______________________.

The  origin of replication is GC rich. true or false

Which of the following enzymes has a major role in joining of DNA fragments (Okasaki fragments) during DNA replication? Group of answer choices DNA gyrase Helicase Primase DNA polymerase DNA ligase

The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during polymerase chain reaction (PCR) replication. Which of the following options best represents the primer?5’ – CGCGTATCGGGCTGTCGCGTCTTGCAGCTCG – 3’   a. 5’ – CGAUACGC – 3’   b. 5’ – CGATACGC – 3’   c. 5’ – CGAGCUGC – 3’   d. 5’ – CGAGCTGC – 3’   e. None of the above

The most likely and immediate affect of the deletion of the Shine-Dalgarno sequence would be: Group of answer choices initiation of replication will not take place 50S subunit cannot form the initiation complex ribosomes will be unable to bind to mRNA mRNA will degrade more rapidly

Can you please check my answer and make sure it is correct. Question: List the ingredients of master mix, and state the purpose of each ingredient.  Answer: Taq DNA polymerase This enzyme synthesizes the complementary strand of the DNA template after attaching to the primer. This means that it adds on free nucleotides to the existing strand, but helps speed up the covalent bonding between these newly added nucleotides. This enzyme is also thermally stable meaning that it can withstand the hot temperatures needed for PCR to occur. This hot temperature is needed for the denaturation step when the double stranded DNA has to be unwound and separated into two strands.  Individual building blocks of DNA (either free nucleotides A, T, C, and G or dNTP’s) These nucleotides are needed to build the complementary strand of DNA A special buffer to maintain the optimal pH, salts, and MgCl2 These buffers help maintain a good pH that doesn’t become too acidic or basic for Taq DNA polymerase to…