8. Label each figure with what TYPE OF CELL is undergoing gene expression: Nuclear membrane DNA Cytoplasm Plasma membrane Nucleus Cytoplasm Mature mRNA Pre-MRNA MRNA DNA Protein Ribosomes Protein Ribosomes

8. Label each figure with what TYPE OF CELL is undergoing gene expression: Nuclear membrane DNA Cytoplasm Plasma membrane Nucleus Cytoplasm Mature mRNA Pre-MRNA MRNA DNA Protein Ribosomes Protein Ribosomes

Name: 8. Label each figure with what TYPE OF CELL is undergoing gene expres
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 8. Label each figure with what TYPE OF CELL is undergoing gene expression:Nuclear membraneDNACytoplasmPlasma membraneNucleusCytoplasmMature mRNAPre-MRNAMRNADNAProteinRibosomesProteinRibosomes

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 5SQ: Mechanisms that govern gene expression do not operate during ___ . a. transcription b. RNA...

See similar textbooks

Similar questions

1d. The csRH mRNA and protein are represented in the diagram below. MRNA 5' AUG 3' ribosome protein signal kinase transmembrane ligand binding domain DNA binding domain sequence domain domain cytoplasm plasma membrane extracellular fluid i. In the boxes on the image, label the N and C termini of the csRH protein. of the csRH protein must be cleaved off before it can be ii. The trafficked along the to the cell membrane. iii. On the schematic above, draw the csRH protein as you would find it at the plasma membrane. Be sure to label the N and C termini of the protein you draw to indicate its orientation. iv. Which protein domains would you NOT expect to find as part of the intracellular hormone H receptor protein icRH?
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Mechanisms that govern gene expression do not operate during ___ . a. transcription b. RNA processing c. translation d. knockouts
D. The sequence of a eukaryotic gene is given below, where in boed an inset containing: 5'GA TTATGGAATTCACCTAT GATCGCAT GGCCATTGAACCT 3 3CTAATACETTAAGTGGATA CTAGCGTA CCGGTAACIT GGA 5 A. Write the sequence of the WRNA produced by its process of transcription and of wRNA that is transferred to ribosomes in order to produce the peptide B. A mutation has occured in the above gene. The GIC pair highlighted replaced by T/A. Cells that are homozygous for that mutation become Cancerous. Do think this gene is a you proto-oncogene? or a tumor suppressor gene and why? describes D₂. The following family tree is given which the way inheritance of a dease. It is noted that only one of its two persons generation I is heterozygous and that one of the individuals in subsequent generations exhibits unexpected Phenotype. Individuals II4 and III2 show its phenotype disease. The remaining individuals have normal phenotype. α
E VG ✓H NA MATEN Match each letter (A through G) to its description. B A ya pada saat ada para a H F காலிமாம்ம் P S —— 1. Receptor 2. RNA 3. Lysosome 4. DNA 5. Ribosome 6. Ligand 7. Kinase domain 8. Nucleus 9. Mitochondria 10. Phosphorylated transcription factor 11. Dephosphorylated transcription factor 12. Plasma membrane
First Position (5'-end) U C A U UUU Phe UUC Phe UUA Leu UUG Leu G CUU Leu CUC Leu CUA Leu CUG Leu AUU Ile AUC Ile AUA Ile AUG* Met GUU Val GUC Val GUA Val GUG Val с UCU UCC UCA UCG Ser Second Position A CCU Pro CCC Pro CCA Pro CCG Pro ACU ACC Ser Ser Ser Thr Thr ACA Thr ACG Thr GCU GCC Ala Ala GCA Ala GCG Ala *AUG also serves as the principal initiation codon. G UAU Tyr UGU UAC Tyr UGC UAA Stop UGA UAG Stop UGG CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA AAG GAU Asp GAC Asp GAA Glu GAG Glu CGU Arg CGC Arg CGA Arg CGG Arg Lys AGA Lys AGG Cys Cys Stop Trp AGU Ser AGC Ser GGU GGC Arg Arg Gly Gly GGA Gly GGG Gly Third Position (3'-end) DOAG DOAG U C U C DOAG DOAG U C U C
Gene A Gene B Gene C Low levels of gene A transcription generates some transcripts of the gene. No transcription of gene B leads to no synthesis of protein B. Continuous transcription of gene C generates many transcripts of the gene. Translation of each of the gene A transcripts generates some protein A. Translation of each of the gene C transcripts generates many molecules of protein C. FIGURE 7.4 The Level of Gene Expression Can Be Controlled ? How does the fact that MRNA is quickly degraded help a cell control gene expression?
w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'