6. Use the image to determine what type of mutation is found in each of the DNA strands below and what type of effect that would have on the protein made. OPTIONS: substitution, deletion, translocation, and insertion. DNA: CCC GGG mRNA: CCC Protein: Pro GAA CTT mRNA: GAA Protein: Glu DNA: DNA: TTA AAT mRNA: UUA Protein: Leu CCA GGT CCA Pro GTA CAT GUA Val TAA ATT UAA Stop Type of Mutation Substitution Substitution Substitution What happens when this type of mutation occurs?

2.  List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

The template strand of a gene includes this sequence. It is mutated at the 5th nucleotide from the 3' position. Draw the double stranded mutated DNA, the resulting mRNA, and the amino acid sequence.

A. MRNA Non Protein Non В. Mut MRNA Protein Non Mut Mut MRNA Non Mut Non Mut Protein Non Mut Biology: How Life Works, Second Edition O 2016 W.H. Freeman and Company Biology: How Life Works, Second Edition O 2016 W.H. Freeman and Company Biology: How Life Works, Second Edition O 2016 W.H. Freeman and Company D. MRNA Protein E. MRNA Protein Non Mut Non Mut Non Mut Non Mut Biology: How Life Works, Second Edition O 2016 W.H. Freeman and Company Biology: How Life Works, Second Edition O 2016 W.H. Freeman and Company Non = nonmutant Which of these pairs of gels would result from a non-sense mutation in exon 4? A E O O O O O