complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II  and transcription factors would bind etc…. I need the correct answer please  From the list given - choose all components that you think are part of a typical eukaryotic gene

Three similar proteins are expressed in human tissues: HHT1 is expressed in the liver,  HHT2 is expressed in the pancreas, and HHT3 is expressed in the heart. You are given the task of investigating how these 3 similar proteins are produced. After investigation, you conclude that: all answers are correct it is possible that HHT1 and 3 are produced via alternative splicing, and HHT2 is encoded by a different gene it is possible that all 3 proteins are encoded by the same gene and produced via alternative splicing it is possible that each of these proteins are encoded by different genes (3 different genes)

We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.

Microbiologists describe the processes of transcription and translation as “coupled” in bacteria. This term indicates that bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation. How is coupling possible in bacteria? Is coupling of transcription and translation possible in single-celled eukaryotes, such as yeast? Why or why not?

This is a list of molecular changes that could happen during DNA replication, transcription, mRNA processing, or translation. For each, determine whether or not the change will be passed down through generations of cells after it occurs. Explain your answer.  C->G point mutation in the DNA of a coding region of a gene A->T point mutation in the noncoding region of a gene An error in transcription changes the mRNA sequence such that what was an amino acid-coding codon in the DNA sequence is now a stop codon in the mRNA sequence. An error in translation causes the amino acid alanine (nonpolar) to be replaced by the amino acid glutamic acid (polar and negatively charged).

Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows (;) indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Give all the possible fully processed mRNAs that could be produced from transcripts of this gene (you don't need to draw anything, just list the regions that would be included in each mRNA by number).

In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In your response, include the following: - differences in what structures (DNA, RNA, proteins etc...) are involved - differences in timing and location - DO NOT include any details on what happens after transcription

Considering Figure 2-13, if you had a homozygous double mutant m3/m3 m5/m5, would you expect it to be mutant in phenotype? (Note: This line would have two mutant sites in the same coding sequence.)

In the early 1960's scientists knew the structure of DNA, however they didn't know how it coded for the expression of proteins. To find out, American Biochemist, Marshall Nirenberg did an experiment and figured out the first codon! To begin he made a solution of Uracil (U), and linked the nucleotides together to form a synthetic RNA molecule which read-UUUUUUU... etc. Therefore, no matter where the message started or stopped, the codon triplets always read UUU, UUU, UUU. Next, he added the poly-U chain to a solution of ribosomes and other ingredients needed for polypeptide synthesis. The result was a polypeptide containing the amino acid phenylalanine. Thus, Niernberg learned that the RNA codon UUU specifies the amino acid phenylalanine. What is the central theme of molecular genetics? Now let's look at the entire process of taking DNA and creating Proteins from that code: Say we have the following nucleotide chain in DNA: T-A-C-T-A-G-C-G-G-A-T-A-G-C-A-T-C-C-C-G-G-G-A-T-A-T-T DNA What…

Which DNA strand will serve as the template strand during the transcription of the RNA-coding sequence?