Cellular Genetics 1. The following sequence of bases is found on one strand of DNA. What is the sequence of bases of the other DNA strand? AACGTTCCG R « XNK ( ! X X K 12 13 19 14 }( } 15 20 21 22 a. Is this a male or a female? 17 18 2. Figure 1.5, shown earlier, illustrates the karyotype of a normal human male. In Figure 1.8, identify the autosomes and the sex chromosomes. c. Can you diagnose the syndrome? FIGURE 1.8 Karyotype for Question 2. Courtesy: National Human Genome Research Institute b. This is an abnormal genetic sequence. What is abnormal about it?

Cellular Genetics 1. The following sequence of bases is found on one strand of DNA. What is the sequence of bases of the other DNA strand? AACGTTCCG R « XNK ( ! X X K 12 13 19 14 }( } 15 20 21 22 a. Is this a male or a female? 17 18 2. Figure 1.5, shown earlier, illustrates the karyotype of a normal human male. In Figure 1.8, identify the autosomes and the sex chromosomes. c. Can you diagnose the syndrome? FIGURE 1.8 Karyotype for Question 2. Courtesy: National Human Genome Research Institute b. This is an abnormal genetic sequence. What is abnormal about it?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1FIO

See similar textbooks

Similar questions

THE MOLECULAR GENETICS OF CYSTIC FIBROSIS 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that regulates the chlorine channels in the cell membrane. This protein contains a total of 1476 amino acids so this is a small part of the entire gene. DNA Template Strand: TAGTAGAAACCACAA 1. What is the minimum number of DNA nucleotides in this whole gene? 4. What amino acids will this mRNA code for? 5. If the 6th, 7th and 8th bases in the template strand of the DNA are removed, rewrite the new template strand below. 1 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 7. What mRNA will be formed from the mutated template strand of DNA? 8. What amino acids will this new mRNA from the mutated template strand code for? 9. Are these…
DNA Replication Drawing Name: Using penci, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate. 1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up which is which) 2 Label the replication fork 3. Draw and label helicase 4. Label the overall direction of DNA replication 5. Draw and label single stranded binding proteins 6. Draw and label the leadng strand 7. Draw and label a single DNA polymerase IIl on the leading strand 8. Draw and label an RNA primer on the leading strand 9. Draw and label a DNA polymerase I on the leading strand 10. On the lagging strand, draw and label at least three Okazaki fragments 11. On the lagging strand. draw and label at least two DNA polymerase IIl…
THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the B chain of hemoglobin. The B chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 8. 7. What mRNA will be formed from the mutated template strand of DNA? What amino acids will this new mRNA from the mutated template strand code for? 9. Are these new amino acids the…
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedure
5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC - 3¹
DNA Typing U S₁ S₂ U S₁ S₂ U S₁ S₂ U S₁ S₂ 0000 Locus 2 Locus 3 Locus 1 U S₁ S₂ 1. In Figure 1.16, blood samples are taken from a gate (U), an injured woman (S₁), and her former husband (S₂). The woman claimed that she was attacked by her former husband. The man had a cut on his hand, which he explained as a cut from a broken water glass. Is the unknown sample from her wound, from her former husband, or from an unknown third person? Locus 1 U S₁ S₂ Locus 2 U S₁ S₂ Locus 4 Locus 3 U S₁ S₂ FIGURE 1.16 Locus 4 FIGURE 1.17 2. From the same case, a second blood sample was collected from a stain on the floor of the former husband's home (Figure 1.17). Is this stain from the woman, her former husband, or an unknown third person?
Do not copy, answer fast and give type answer only Thanks a lot Which of the following is wrong for the description of protein synthesis(A) The large ribosomal subunit is constructed by proteins and ribosomal RNAs. (B) tRNA is necessary for protein synthesis.(C) DNA components are required.(D) GTP is required for the process. Alleles segregate independently of other alleles because:(A) Maternal and paternal chromosomes line up on the either side of the equator during metaphase I.(B) Crossing over in prophase I.(C) Separation of homologous chromosomes in anaphase I.(D) A and B(E) A and C Which statement is wrong for the transcription factors?(A)They can bind to the region out of the promoter.(B)They have two domains, one that binds DNA and the other that activates transcription. (C)Their functions are limited for transcription.(D)They can bind to activators. which statement about biotech is wrong? (A)DNA microarray assay can detect gene expression (B)RT-PCR cannot detect gene…
DNA replication in [Select] These are [Select] at the [Select] [Select] [ Select ] Gametes (sperm or egg) are Each member of a pair of [Select ] different parent at fertilization, one from Mom (maternal) and one from Dad (paternal). [ Select ] phase results in that are connected to each other When they join, the resulting zygote is [Select] undergoes [Select] comes from a of all genetic information. and have and to make a multicellular body
Genome Assembly with Perfect Coverage and Repeats Given a list of error-free DNA 3-mers taken from the same strand of a circular chromosome. Find all circular strings assembled by complete cycles in the de Bruijn graph B2. Find the circular chromosome sequence. Dataset: ATC ATG CAT CCA GAT GGA TCC TGG
On the 4 diagrams below show the four different ways (which strands are cut and where for each Holliday junction) that the Holliday junction structures can be resolved and denote whether this leads to a recombination event or not." 3 1 IT |? 3 ||| |AL||T|||c| |||| 4 5 6 TIT!!T?L|| ?|||?| |||| TIT|| |AL||T|||C| |||| 4 5 6 3 3' 3 T?L|| ?| ||?| |!!! || |A|||T| |jcj ||| 4 5 6 TI T?L|| ?|||?T ||| jT|| |ALİ|Ti||c| ||| 4 5 6