Cellular Genetics 1. The following sequence of bases is found on one strand of DNA. What is the sequence of bases of the other DNA strand? AACGTTCCG R « XNK ( ! X X K 12 13 19 14 }( } 15 20 21 22 a. Is this a male or a female? 17 18 2. Figure 1.5, shown earlier, illustrates the karyotype of a normal human male. In Figure 1.8, identify the autosomes and the sex chromosomes. c. Can you diagnose the syndrome? FIGURE 1.8 Karyotype for Question 2. Courtesy: National Human Genome Research Institute b. This is an abnormal genetic sequence. What is abnormal about it?
Q: 3. Draw a depiction of the following chromosomal abnormalities: a. Paracentric Inversion b. Terminal…
A: The chomosomal abnormalities are two different types. Those are, changes in the number - those are…
Q: If pB253 were cleaved with BamHI and Sacl, what are the sizes of the two DNA fragments that would…
A: Restriction enzyme aslo called restriction endonuclease is the molecular seasor they recognised the…
Q: Select the processes that only happen inside the nucleus of a eukaryotic cell. Select all that…
A: Eukaryotic cells make up the eukaryotic body. These are more advanced organisms because their…
Q: LM (1200) LM (1200) Identify the formed element labeled "a." LM (1200x
A: All the 3 pictures is taken under a microscope of a blood sample. Inside blood, different types of…
Q: Explain in 2-3 sentences Description: Examples in the body: a. Diffusion b. Osmosis c.…
A: Membrane transport describes a group of transport processes that regulate how ions and other solutes…
Q: After a cross between two corn plants, the F₁ plants all had a dwarf mutant phenotype. The F2…
A: Here, the correct answer is D) d/d (dwarf), d+/d+ (tall)..
Q: Question 8 Glucose labeled with 14C at C5 is incubated with the glycolytic enzymes and necessary…
A: Glycolysis is the first step of cellular respiration that occurs in both presence and absence of…
Q: A pure breeding purple flower is crossed (mated) to a pure breeding white flower. The F1 offspring…
A: Incomplete dominance occurs when both alleles of a gene are only partially expressed at a location.…
Q: What effect does a high carbon level have on the deep ocean? Why might it be important to keep an…
A: A high carbon level in the deep ocean can have several effects:Ocean Acidification: Elevated carbon…
Q: Drugs that increase the effects of the neurotransmitter GABA 1. improve motor control 2. reduce…
A: GABA also known as Gamma-aminobutyric acid is an inhibitory neurotransmitter. It helps in reducing…
Q: Which of the following protein is a glycoprotein as evidenced by the provided illustration and…
A: Plasma membrane of the cells is the selective barrier and is made up of phospholipid bilayers. The…
Q: One example of non-Mendelian inheritance is uniparental inheritance. Choose the definition of…
A: Non-Mendelian genetics refers to inheritance patterns that do not follow the simple Mendelian…
Q: You were working with mouse mitochondrial proteins, and as a routine, you have isolated muscle…
A: Mitochondria is important cell organelles having various important functions in the cell Function of…
Q: ease select the diseases that are often caused by S. pyogenes. Check All That Apply impetigo…
A: Group A Streptococcus, also known as S. pyogenes, can lead to several illnesses.
Q: The diagram below shows the normal sequence of a particular protein, along with several mutant…
A: Original Sequence: Met Gly-Glu-The-Lys-Val-Val- -ProMutant Sequence: Met-GlyMutation Description: In…
Q: In horses, the Overo gene, Ov, produces a white splotch pattern on the coat. The overo phenotype is…
A: The Overo gene (Ov) in horses produces a white splotch pattern on the coat when present in a single…
Q: What are functions of the M7G cap? Select all the apply. Slows degradation from the 5' end of the…
A: The process by which mRNA is produced from DNA is called transcription and the process by which…
Q: Tackle the question of how we determine membership in a particular species?
A: Definition A species is a group of organisms having similar features. A particular species has…
Q: Which of the following is false about the lipid rafts on the plasma membranes? The lipid rafts may…
A: Lipid rafts are specialized microdomains inside eukaryotic cell plasma membranes.They are…
Q: In the diagram below, which Okazaki fragment was produced first, A, B, or C? Fragment A Fragment B…
A: Okazaki fragments are recently formed segments of DNA that emerge during the process of DNA…
Q: VITATI KEY: Positive charge: Purple, Negative Charge: Pink Hydrophilic: Green Hydrophobic: Brown…
A: In the study of proteins and amino acids, it is crucial to understand their interactions with their…
Q: 4. While triple-X human females typically have normal offspring, what kinds of gametes, with respect…
A: In humans, the X chromosome is one of two sex chromosomes, the other is the Y chromosome. One of the…
Q: You are studying the effects of temperature and lipid composition on membrane fluidity using…
A: The cell membrane, also known as the plasma membrane, is a thin, flexible barrier that surrounds the…
Q: Question 5 (1 point) Listen Saved Channel proteins transport large macromolecules lipids and…
A: The main purpose of a channel protein is to transport the ions and water molecules quickly through…
Q: Using the word bank below, fill in the blanks in the diagram with the correct part of the cycle. •…
A: All living organisms, including plants and animals, depend on the nitrogen cycle, a natural…
Q: What happens when a helper T cell is activated?
A: An example of an immune cell is the helper T-cell. They are among the major cell types that are…
Q: The current flowing through individual ion channels has a different reversal potential than the…
A: Ion channels are proteins in cell membranes that control the flow of ions in and out of cells. They…
Q: bob consumes about 2500 kcalories per day, which is apportioned as 150g of fat, 140g of…
A: The nutrients we need in large quantities in our daily life and that give us energy is known as…
Q: How does the natural process of meiosis support evolution? • A. It does not support evolution. B.…
A: Cell division known as meiosis takes place in organisms that reproduce sexually. It creates cells…
Q: Senescence markers are highly exhibited by these groups of cells (Choose all that apply); Group of…
A: Senescence markers are vital in numerous areas of research, including development, multiplication,…
Q: The genetics research lab has sequenced a genomic region with 1000000 basepair of an unknown…
A: The effective population size (Ne) of a species is the number of individuals in an idealized…
Q: Give typed explanation
A: During meiosis, homologous chromosomes, which have the same genes but may carry different alleles,…
Q: Suppose a species of tulip has three alleles for the gene that codes for flower color. The CR allele…
A: In this above question we have to know two things That one is CR is dominant over Cp and Cw and Cp…
Q: The figure below illustrates the development of white blood cells from stem cells in the bone marrow…
A: White blood cells, or leukocytes, are vital components of the human immune system. They originate…
Q: It is possible to treat addiction by prescribing drugs that block the effects of the psychoactive…
A: Psychoactive compounds are chemicals that change brain function by influencing perception, mood,…
Q: Microscope parts Oculars/ Eyepiece Objective Lenses Objective Turret Light Source Diaphragm…
A: A microscope is a scientific tool used for magnifying and studying tiny objects or specimens. It…
Q: In the graph below, the top line (with the triangles) represents the of the three curves. In the…
A: Population growth is the increase in the number of humans on Earth.
Q: DNA Typing U S₁ S₂ Locus 1 U S₁ S₂ U S₁ S₂ Locus 1 Locus 2 U S₁ S₂ U S₁ S₂ Locus 2 Locus 3 1. In…
A: A forensic method referred to as DNA typing, commonly referred to as DNA profiling or DNA…
Q: Presence or Absence of Nucleus? a. Blood b. Protozoa c. Bacteria
A: The nucleus stands as a membrane-bound organelle residing within eukaryotic cells, which compose…
Q: Discuss early events in the sensing of abiotic stress by plants and the acclimation pathways…
A: Membrane Stability and Integrity:Lipid Peroxidation : When plants encounter abiotic stress, one of…
Q: In the pedigree below what is the expected mode of inheritance?
A: Pedigree analysis helps us to understand the mode of inheritance of a particular trait (disease) by…
Q: A 145lb patient is to receive a single IV dose of ondansetron 0.15mg/kg, in addition to other drugs,…
A: If a medication is not used as prescribed, it may do more damage than good. A dosage, often known as…
Q: 12 mM of protein A is combined with 6 mM of ligand X in water. After the protein-ligand complex…
A: The question is asking for the dissociation constant (Kd) for protein A. In this scenario, protein A…
Q: What is the Similarities and Difference between Prokaryotic Cells and Eukaryotic Cells Similarities:…
A: Prokaryotic cells are simple, lack a true nucleus, and do not have membrane-bound organelles. They…
Q: What codon results in a release factor entering the ribosome? 5' M GPPP-…
A: Translation is a process of formation of protein from mRNA. This process takes place in the…
Q: Compare and contrast an animal cell from a plant cell
A: Cell:The cell is defined as the fundamental, smallest, structural, functional and biological unit of…
Q: Which structure is highlighted? Multiple Choice O xiphoid process of the sternum body of the sternum…
A: The rib cage, a basket-like skeletal component that makes up the upper part of the body, or thorax,…
Q: Describe how the heart as a muscle does its job of pumping blood. What happens if the cardiac muscle…
A: The heart is primarily composed of cardiac muscle tissue, which contracts rhythmically to pump blood…
Q: e to that on the other side of the inner mitochondrial membrane. higher, higher, lower, the same,…
A: Electron transport chain is the final step of aerobic cellular respiration in which electrons…
Q: interphase and interkinesis
A: The cellular life cycle, a well-orchestrated series of events, guides cells through replication and…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- THE MOLECULAR GENETICS OF CYSTIC FIBROSIS 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that regulates the chlorine channels in the cell membrane. This protein contains a total of 1476 amino acids so this is a small part of the entire gene. DNA Template Strand: TAGTAGAAACCACAA 1. What is the minimum number of DNA nucleotides in this whole gene? 4. What amino acids will this mRNA code for? 5. If the 6th, 7th and 8th bases in the template strand of the DNA are removed, rewrite the new template strand below. 1 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 7. What mRNA will be formed from the mutated template strand of DNA? 8. What amino acids will this new mRNA from the mutated template strand code for? 9. Are these…DNA Replication Drawing Name: Using penci, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate. 1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up which is which) 2 Label the replication fork 3. Draw and label helicase 4. Label the overall direction of DNA replication 5. Draw and label single stranded binding proteins 6. Draw and label the leadng strand 7. Draw and label a single DNA polymerase IIl on the leading strand 8. Draw and label an RNA primer on the leading strand 9. Draw and label a DNA polymerase I on the leading strand 10. On the lagging strand, draw and label at least three Okazaki fragments 11. On the lagging strand. draw and label at least two DNA polymerase IIl…THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the B chain of hemoglobin. The B chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 8. 7. What mRNA will be formed from the mutated template strand of DNA? What amino acids will this new mRNA from the mutated template strand code for? 9. Are these new amino acids the…
- Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedure5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
- 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC - 3¹DNA Typing U S₁ S₂ U S₁ S₂ U S₁ S₂ U S₁ S₂ 0000 Locus 2 Locus 3 Locus 1 U S₁ S₂ 1. In Figure 1.16, blood samples are taken from a gate (U), an injured woman (S₁), and her former husband (S₂). The woman claimed that she was attacked by her former husband. The man had a cut on his hand, which he explained as a cut from a broken water glass. Is the unknown sample from her wound, from her former husband, or from an unknown third person? Locus 1 U S₁ S₂ Locus 2 U S₁ S₂ Locus 4 Locus 3 U S₁ S₂ FIGURE 1.16 Locus 4 FIGURE 1.17 2. From the same case, a second blood sample was collected from a stain on the floor of the former husband's home (Figure 1.17). Is this stain from the woman, her former husband, or an unknown third person?Do not copy, answer fast and give type answer only Thanks a lot Which of the following is wrong for the description of protein synthesis(A) The large ribosomal subunit is constructed by proteins and ribosomal RNAs. (B) tRNA is necessary for protein synthesis.(C) DNA components are required.(D) GTP is required for the process. Alleles segregate independently of other alleles because:(A) Maternal and paternal chromosomes line up on the either side of the equator during metaphase I.(B) Crossing over in prophase I.(C) Separation of homologous chromosomes in anaphase I.(D) A and B(E) A and C Which statement is wrong for the transcription factors?(A)They can bind to the region out of the promoter.(B)They have two domains, one that binds DNA and the other that activates transcription. (C)Their functions are limited for transcription.(D)They can bind to activators. which statement about biotech is wrong? (A)DNA microarray assay can detect gene expression (B)RT-PCR cannot detect gene…
- DNA replication in [Select] These are [Select] at the [Select] [Select] [ Select ] Gametes (sperm or egg) are Each member of a pair of [Select ] different parent at fertilization, one from Mom (maternal) and one from Dad (paternal). [ Select ] phase results in that are connected to each other When they join, the resulting zygote is [Select] undergoes [Select] comes from a of all genetic information. and have and to make a multicellular bodyGenome Assembly with Perfect Coverage and Repeats Given a list of error-free DNA 3-mers taken from the same strand of a circular chromosome. Find all circular strings assembled by complete cycles in the de Bruijn graph B2. Find the circular chromosome sequence. Dataset: ATC ATG CAT CCA GAT GGA TCC TGGOn the 4 diagrams below show the four different ways (which strands are cut and where for each Holliday junction) that the Holliday junction structures can be resolved and denote whether this leads to a recombination event or not." 3 1 IT |? 3 ||| |AL||T|||c| |||| 4 5 6 TIT!!T?L|| ?|||?| |||| TIT|| |AL||T|||C| |||| 4 5 6 3 3' 3 T?L|| ?| ||?| |!!! || |A|||T| |jcj ||| 4 5 6 TI T?L|| ?|||?T ||| jT|| |ALİ|Ti||c| ||| 4 5 6