In the diagram below, which Okazaki fragment was produced first, A, B, or C? Fragment A Fragment B Fragment C A B overall directions of replication C

In the boxes below, complete the Original DNA, DNA Copy and/or RNA

The bacterial primase enzyme synthesizes _______________________.   a short DNA primer using RNA as a template a short protein primer using RNA as a template an RNA strand in absence of template DNA a short DNA primer using DNA as a template a short RNA primer using DNA as a template

To test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…

please dont give hand writting solution please

explain the term semiconservative replication?

In E. coli, the leading strand is primarily synthesized by:       DNA polymerase ε   DNA polymerase I   DNA polymerase II   DNA polymerase δ   DNA polymerase III

Given the replication events listed below which even takes place first Single Strand binding proteins bind Primase adds an RNA primer Helicase unwinds the DNA double helix  DNA polymerase begins adding DNA nucleotides

A friend asks for help understanding replication for the next biology test. (S)he draws a replication bubble for a DNA molecule being replicated. The origin of replication is shown (0) and newly replicated DNA is shown as gray.  Small gray arrows represent okazaki fragments. Solid gray lines represent leading strand. Draw a corrected version of a replication bubble below.

Use the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy.   What is the smallest fragment size that the NcoI/EcoRI double digest produces?