Because DNA can only be synthesized in the 5' to 3' direction...   A. The template DNA must be read in the 3' to 5' direction   B. One of the two strands of ds DNA must be synthesized in short fragments   C. Both A and B   D. Neither A nor B

Place the steps of sanger sequencing in order.A.  A fluorescent laser excites the fragments and records the wavelength consistent with a single nucleotide. B.  ddNTPs bind and stop chain extension.C.  DNA fragments are separated by size through a capillary tube. D.  DNA polymerase copies the target region of template DNA.E.  The final nucleotide of each fragment is labeled with a fluorescent tag.

DNA that has been  labeled with 15N is used as the template for replication. Replication is carried using 14N labeled dNTP's. After 3  rounds of replication, what percent of DNA molecules have one strand containing 15N and one strand containing 14N?   A. 50%   B. 75%   C. 25%   D. 100%

Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand be? 5’ ATAGATGAAGCCCCACGCCTA 3’ (coding strand of DNA) 3’                                                    5’ (template strand or non-coding strand of DNA) 5’                                                     3’ (mRNA strand) a. UAUCUA b. GCGAGT c. TATCTA

The lagging strand is replicated with stretches of Okazaki fragments and its synthesis is considered to be A. discontinuous. В. continuous O c. conservative D. semiconservative

What will most likely be the effect of the change in the DNA molecule? *   A. the change will cause a harmful mutation   B. the DNA molecule will be unable to replicate   C. the organism will be reproduce   D. the DNA molecules will code for a different protein Original strand: T A C G T A T G A A G C, Mutant strand: T A G C T A T G A A G C. what type of mutation? *   A. Substitution   B. Deletion   C. Insertion   D. Nonsense Which mechanism contributes to accuracy during DNA Replication? *   A. The mismatch repair system recognizes an incorrect base-pair and corrects the mistake in the non-methylated strand   B. Using primers increase accuracy because the first nucleotides is a new nucleic acid chain are more like to be correct.   C. all DNA polymerase have a 5'-3' exonuclease activity which can remove…

A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter strand. What will the sequence of the primer be? A. ATCGTTAGCGT B. ATGGTTAGGGT C. AUCGUUAGCGU D. AUCGTUAGCGT

Which of the following enzymes is NOT involved in DNA replication?   a. DNA Polymerase   b. Primase   c. Helicase   d. Phosphatase   e. DNA Ligase

Which mechanism requires the ability to distinguish between newly synthesized and template strands of DNA? a. Nucleotide selection b. DNA proofreading c. Mismatch repair d. All of the above

Certain restriction endonucleases produce cohesive (sticky) ends.  This means that they: a. stick tightly to the ends of the DNA they have cut. b. cut both DNA strands at the same base pair. c.   make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding.   d. cut in regions of high GC content, leaving ends that can form more hydrogen bonds than ends of high AT content. e. cut in regions of high AT content, leaving ends that can form more hydrogen bonds than ends of high GC content.