and set up a series of four dideoxy reactions (the dideoxy nucleotides are labeled with radioactive P32 ).    You then separate the products of the reactions by gel electrophoresis and obtain the following banding pattern:      a) Write out the base sequence of the newly synthesized strand from reading the gel (include the 5’ and 3’; end)  b) Write out the base sequence of the original fragment you were given (include the 5’ and 3’ end)

All guanines in the top strand of the following sequence are converted from the 'keto' tautomer to the 'enol' tautomer, resulting in pairing with thymine. (top strand) 5' TAGCATGCAA 3' (bottom strand) After a few rounds of replication, what will the sequence of the mutated top strand be? (5' to 3') (Newly incorporated nucleotides are in the 'keto' form.) 3' ATCGTACGTT 5'

The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'

You have begun your career in medicinal biochemistry and have just discovered a bacterial DNA plasmld (transferabl ring of DNA) that appears to destroy the Ebola virus. In order to characterize your new plasmid, the molar mass of the plasmid must be determined. You dissolve 25.00 mg of the purified plasmid in 0.200 mL of water at 2 °C and find the osmotlc pressure of this solution is 1.20 Torr at 20 °C and 1 atm pressure. Answer the following about the Ebola-killing plasmid. 33.) The osmotlc pressure of the system is: (a) 1 atm (b) 0.016 atm (c) 6.5 X 10-5 atm (d) 22.59 atm (e) 0.0016 atm

1. What role does a patient's genetics have in their symptoms of muscular dystrophy? What causes various mutations to cause distinct symptoms? (two to three sentences) (Think about why various mutations in different genes cause different illnesses.)2. What can family history teach you about a patient's muscular dystrophy inheritance and, hence, genetic basis? (two to three sentences)3. The X-chromosome contains the mutation that causes Duchenne Muscular Dystrophy (DMD). Explains how this impacts DMD inheritance and why DMD patients are disproportionately male. (two to three sentences)

For linear 34,000 kb DNA calculate a) contour length; b) the length of DNA as packaged in nucleosomes and c) the length of the DNA in a 30-nm fiber.

What is the purpose of the dideoxynucleotide triphosphates in the Sanger sequencing reaction? A) The ddNTP prevents the denatured DNA in a sequencing reaction from re-forming a double helix. B The ddNTP terminates synthesis on a strand after it is incorporated by DNA polymerase. (C) The ddNTP acts as a catalyst for the DNA polymerase during in vitro DNA replication. The ddNTP is necessary to act as a primer in a sequencing reaction.

You are studying a colony of cells and determine that some of these cells have a mutated DNA polymerase I that results in loss of function of this enzyme. A)   What will the effect of the mutation in DNA polymerase I be on DNA replication? In your answer make sure to describe what would be observed in the leading and lagging strand and explain your reasoning.  B)   Will this mutation in DNA polymerase I have an impact on another step in DNA replication? In your answer make sure to indicate whether DNA replication will be impacted or not. If it is not, explain why. If it is impacted, then describe the step that is impacted and name the molecule or enzyme involved.

The A and G compositions (mole percent) of one of the strands of a duplex DNA is A = 27 and G = 30. (a) What would be the T and C compositions of the complementary strand? (b) What can be said about the A and G compositions of its complementary strand?

Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene.    a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligase