Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.

Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.

Name: Although techniques are available for determining the sequences of ami
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

A very common molecular biology research method is to analyze cell or tissue homogenates by SDS-polyacrylamide gel electrophoresis and immunoblotting (Western blot). What can we learn about a protein of interest from this type of analysis? More than one answer is correct. Options: Determine the tertiary structure of the protein of interest. Determine or verify the molecular weight of the protein of interest. Compare the levels of the protein of interest in two different cell types. Determine the amino acid sequence from the product ion spectrum. Determine the intracellular binding partners of the protein of interest.
Explain how a multiple sequence alignment can identify functional sites in a genetic sequence.
Discuss the benefits of being able to predict protein structure from the DNA sequence (proteomics).
E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long? This requires knowing how many nucleotides of DNA code for one amino acid. F. Assuming that there are between 20,000-25,000 genes in the human genome, do you think there are 1) fewer, 2) approximately the same number, or 3) more proteins in the human genome? Explain your answer.
Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal determination, a biochemist found out that there are two N-terminal amino acid residues, V and G. What is the original sequence of the protein given the following peptide fragments: after digestion with Chymotrypsin: G-L-S-R-G-M-w V-A-L-F Q-L-Y L-R-V-W G-M-V-E-A-D-I-P K-S-P-E-M-T-W R-M-A-S-E-K-P-G-H after digestion with Trypsin: P-G-H V-W-G-M-V-E-A-D-I-P M-A-S-E-K G-M-W-Q-L-Y-L-R S-P-E-M-T-W-R G-L-S-R V-A-L-F-K after digestion with Cyanogen Bromide: T-W-R-M W-Q-L-Y-L-R-V-W-G-M V-E-A-D-I-P A-S-E-K-P-G-H V-A-L-F-K-S-P-E-M G-L-S-R-G-M
A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: — AATTGCCCGATCGATTAAGCCA — Sequence with treatment: — AATTGTTTGATCGATTAAGCTA —
Describe how two protein sequences are aligned, and how one can determine whether that alignment is significant.
One of the most confusing aspects of determining the protein sequence that will be derived from a gene is keeping track of the polarity or directionality of each nucleotide sequence strand. Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
What does the symbol “N” indicate (see the arrow)? Is this a problem for getting an accurate DNA sequence? The height of the peak in the figure is an indication of the quality of the data, with a high peak correlated with a low error in “base-calling” of perhaps 1 error in 10,000 bases. Is this generally a high-quality DNA sequence for determining the true DNA sequence of the gene studied? How can you tell? Which end of the sequence shown above is the 5’ end of the sequence being made via PCR.
Use the sequence alignment tool Smith and Waterman for the amino acid number 16-30 of the protein sequences Q4VW83 and Q4VW8
Describe how proteins are sequenced, and explain why sequence determination is important