On the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA?
Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: 4A.According to Watson-crick base-pairing rule- Double-stranded DNA is complementary in nature that…
Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…
A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…
Q: If a single strand of a gene contains 678 bases, how many amino acids result in the polypeptide…
A: The biochemical substance that is carried from the preceding generation to the succeeding generation…
Q: If the MC1R protein is 317 amino acids long, why are there 954 base pairs in the coding region of…
A: The proteins are produced by the amino acids that are produced by the translation process. During…
Q: What percentage of the human genome is nowpredicted to have functionality in at least one cell type?
A: The gene is the basic physical and functional unit of heredity. The genome is the genetic material…
Q: Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: which DNA sequences are commonly found at human centromeric regions?
A: The cell biology is considered as the study of cells, their structure, and their functions. The…
Q: What is the difference between core genome and pan genome?
A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…
Q: What proportion of exons are repeated sequences in the human genome? Is 38% surprising?
A: Human Genome is comprised of only 1.1% exons of the total, whereas 24% is in introns, and the…
Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…
A: 1. Each amino acid corresponds to a codon and each codon is made up of sequence of three nucleotide…
Q: Why is the term “proteome” ambiguous, whereas the term“genome” is not?
A: The proteins are the essential part of living organisms and it consists of thousands of smaller…
Q: How many of each base is found in the complete double-stranded molecule?
A: The concept is based on Chargaff's rule. It is given by Erwin Chargaff to calculate the amount of A,…
Q: Can numerous paralogs in a genome lead to genome expansion? and how?
A: According to the question, we have to explain that numerous paralogs in a genome can lead to genome…
Q: Clearly, all humans have variations in their DNA sequences. How is it possible to sequence the human…
A: Answer- All the organism have certain amount of similarities in the DNA sequnece. In all the human…
Q: How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested…
A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…
Q: How many protein-encoding genes are in the human genome?
A: Genome refers to the genetic material of an organism, which consists of deoxyribonucleic acid (DNA).…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: Genetics is the study of how traits are passed from one generation to another. This includes but is…
Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: Approximately what percentage of the human genome isderived from transposable elements?a. 10%b.…
A: Introduction:- Transposable elements are DNA sequences that have the ability to travel or transfer…
Q: The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how…
A: Recombination is the process of genetic reshuffling where the genetic material is shared within or…
Q: Approximately what portion of the human genome is composed of repeat sequences?
A: According to the results found in the human genome studies it is seen that the human genome has…
Q: How do we know if a genomic DNA sequence contains aprotein-coding gene?
A: Only about 1% of DNA contains protein-coding genes; the remaining 99 percent is noncoding. Noncoding…
Q: What are the frequency and percentage distribution of amino acids in the polypeptides coded by the…
A: The frequency and percentage distribution of amino acids in the polypeptides coded by the Original…
Q: The best estimate is that the human genome containsfewer than 21,000 genes. However, there is…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is…
Q: When the human genome sequence was finally completed, scientists were surprised to discover that the…
A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…
Q: How many SNPs are in the human genome?
A: The human genome consists of about 3 million base pairs and 23 pairs of chromosomes. Out of these,…
Q: Why is the genome contained within a membrane?
A: A genome is a complete set of "genetic information" in an organism. It stores all of the information…
Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: Hemoglobin present in red blood cells helps in the transport of oxygen molecule to and from various…
Q: In humans, there may be three times as many proteins as genes. If each gene encodes a protein, how…
A: DNA gets condensed to form chromosomes during cell division. Chromosomes are rod shaped chromatin…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…
Q: What are transposable elements? Explain the mechanism by which they move from one location to…
A: A transposable element (TE or transposon) is a DNA sequence that may move around inside a genome,…
Q: Could a single nucleotide deletion restore the function of a protein-coding gene interrupted by the…
A: Introduction: The functional unit of DNA that code for proteins are known as genes.
Q: How many codons are there in the mutated DNA-(b) and DNA-(c)? What types of mutations occurred in…
A: Codon is sequences of three DNA or RNA nucleotides.
Q: Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?
A: DNA contains the instructions for protein synthesis. Proteins in turn determine structure and…
Q: What happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?
A: Gene is a stretch of DNA that codes for a particular polypeptide chain.
Q: Approximately how many Okazaki fragments are synthesized in thereplication of the human genome?
A: Okazaki fragments are short sequences of DNA nucleotides, which is synthesized during replication…
Q: What is the central dogma of biology? Describe the molecular processes that accomplish the flow of…
A: Central Dogma of Biology: The flow of genetic information from DNA to RNA which is…
Q: What is a genome and what is it composed of? What is thecentral dogma of molecular biology?
A: Genes are the hereditary units that are transmitted from one generation to another generation. The…
Q: For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides…
A: Transcription is the DNA dependent RNA synthetic process. RNA polymerase help in the transcription.…
Q: What is a nucleosome-free region? Where are such regions typically found in a genome? How are…
A: Given: Explain about the nucleosome-free region. and explain such regions typically found in a…
Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: Blood is a body fluid that carries necessary nutrients and oxygen to the cells and transports…
Q: Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the…
A: Amino acids are the organic compounds that acts as the building block of protein molecules. Proteins…
Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…
A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…
Q: Nearly _______of the Human GenomeConsists of Transposable Elements?
A: The transposable elements are the DNA sequence that may change its position or location within the…
On the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA?
Step by step
Solved in 2 steps
- Approximately what portion of the human genome is composed of repeat sequences?The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
- How many bits of information are stored in an 8-mer DNA sequence? In the E. coli genome? In the human genome?Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
- What fraction of the human genome consists of transposons and retrotransposons?If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = argininePinker mentions that only 1% of the human genome codes for proteins (the rest included introns, regulatory sequences, and repetitive DNA, some of it parasitic—we will talk about this later). Given that the human genome contains 3 x 109 base-pairs of DNA, there are about 20,000 human genes, and three base pairs code for each amino acid in a protein, how many amino acids are in the average human protein? [Hint: start with what fraction of base pairs in the human genome code for proteins.]
- A DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine, guanine, and thymine). (a) How many DNA sequences are exactly 24 letters long? (b) Given a DNA sequence of length 24, how many single letter mutations are possible? (c) Given a DNA sequence of length 24, how many double letter mutations are possible?Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.