A normal cell has no growth factor bound to the growth factor receptor. What do you predict about ERK in this situation? it will activate a transcription factor it will be phosphorylated it will not be phosphorylate it will not go into the nucleus 4
Q: 27) If the sequence TCGTA was used as a template in DNA replication, what would the sequence of…
A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…
Q: what are structures and functions of enzymes?
A: Enzymes are catalysts which help in altering and speeding up the rate of reaction without getting…
Q: Continued exposure to addictive drugs causes ______, reduced activity in several frontal lobe…
A: The frontal lobe generally executes high-level cognitive processes in the brain such as…
Q: Give typed full explanation
A: This is a kind of a bone attached to a joint. A large cavity can be identified in this arrangement.
Q: ease select the diseases that are often caused by S. pyogenes. Check All That Apply impetigo…
A: Group A Streptococcus, also known as S. pyogenes, can lead to several illnesses.
Q: Cataracts develops
A: Cataracts:These are the eye conditions which are common where the natural lens of the eye becomes…
Q: How is cigarette smoking related to elastase function? Methionine sulfoxide is formed by cigarette…
A: lastase is an enzyme, specifically a protease, that plays a critical role in the breakdown of…
Q: Question 8 Myoglobin and the subunits of hemoglobin have: O very similar primary and tertiary…
A: Hemoglobin is an iron-containing protein, present on the surface of RBCs and carries oxygen from…
Q: What method did Coghill suggest to produce penicillin?.
A: A number of diseases can be managed and treated using penicillin. It is a kind of antibiotic known…
Q: How many chromosomes are shown in this picture? O 1 1234 O 5 ↑
A: A chromosome is a long, thread-like structure found in the nucleus of a cell. It carries genetic…
Q: cross between two heterozygotes fruit flies with purple eyes and white bodies (EeBb) results in 4…
A: Parent 1: EeBbParent 2: EeBbEye color : EeHomozygous dominant (EE): Purple eyesHeterozygous (Ee):…
Q: Which statement best describes how molecular complementarity enables specificity during a signaling…
A: Cell signalling, also known as cell communication, is a cell's ability to receive, analyse, and…
Q: In the mid-1990s, researchers discovered an enzyme in HIV called protease. Once the enzyme's…
A: The substances that inhibit the activity of enzymes are called enzyme inhibitors and the mechanism…
Q: Acidification of the stomach uses all of the following types of transport EXCEPT: O symporters O…
A: The parietal cells in the proximal two-thirds (body) of the stomach release acid. Gastric acid aids…
Q: Based on these graphs, and assuming head raises of European finches helps watch for predators but…
A: The first graph (a) depicts the relationship between the total head raises of the flock per minute…
Q: This food web represents part of a terrestrial community that is very similar to Millbrook Marsh.…
A: When several interlinking food chains are present in a particular area at a particular time then it…
Q: You are required to select your organisms from four different phyla. You cannot use the same phylum…
A: Phylum Mollusca:Organism: Giant Clam (Tridacna gigas)Taxonomic Structure: Kingdom: Animalia, Phylum:…
Q: QUESTION 2 Most sensory stimuli are interpreted in: 00 the cerebrum sensory receptor cells O…
A: Actin is a crucial protein found in cells, particularly in muscle cells. It plays a fundamental role…
Q: The following sequence alignment shows the point mutation that exists in hemoglobin for some cases…
A: In the field of molecular biology and bioinformatics, the comparison plus the analysis of the…
Q: What behaviors during the egg-laying season might lead to potential behavioral adaptations that…
A: characters During the breeding season,the following behaviors can lead to behavioral changes that…
Q: In transformation, a bacterial cell takes up DNA fragments from its surroundings. The figure shows…
A: Bacteria transform themselves by ingesting DNA from their surroundings. Griffith first outlined this…
Q: Which of the following statements is TRUE about the topologies of the trees shown below? All four…
A: A hybrid network architecture known as a tree topology, or star-bus topology, connects star networks…
Q: The genes for the human type I IFNs lack introns and those those encoding 14 subspecies of IFN-α,…
A: Genes are the part of DNA that undergoes expression and produces RNA. Eukaryotic genes contain both…
Q: edigree and determine which of the following modes of inheri ait: dominant recessive minant essive…
A: A pedigree is made on different modes of inheritance that could be autosomal or sex linked.…
Q: Impulsiveness: A) has been linked to functional and structural changes in the brains of drug…
A: Impulsivity is a complex trait that is influenced by a variety of factors, including genetics, brain…
Q: Evolution results from A. mutations. B. natural selection. C. genetic drift. D. gene flow. E.…
A: It is the change in the characteristics of species over generations. It relies on the process of…
Q: Label the diagram: 3'4 5' Primer 5' 15' '3'
A: The heterocatalytic processes by which a new DNA strand is synthesized on a old DNA template is…
Q: If the clamp loader on DNA Pol III were not efficient at loading the new clamp, which strand of the…
A: DNA Polymerase III is a complex protein involved in DNA replication. It has several subunits,…
Q: Part II. Basic Body Plans Cross Section of Planaria Cross Section of Roundworm
A: A cross section or T. S also known as an axial plane is obtained by dividing the body into head and…
Q: Which of the following is an advantage of confocal microscopy over conventional fluorescence…
A: One significant advantage of confocal microscopy compared to conventional fluorescence microscopy is…
Q: See image
A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…
A: Chromosomal aberration - It is defined as the change in chromosome structure and number.Change in…
Q: is i 5' AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT Ċ (c) wha 3' 5' se that…
A: Transcription is a process in which mRNA is synthesized with the help of DNA by the help of the…
Q: Write down the energy content in kilo-calories (kcal) from one gram of fat, one gram of carbohydrate…
A: In the context of nutrition and dietary science, it is essential to understand the energy content of…
Q: Draw a diagram/graph to represent the results of an experiment that would prove that there was…
A: Horizontal gene transfer is a method of gene transfer between two unrelated species. Here a…
Q: You are studying the effects of temperature and lipid composition on membrane fluidity using…
A: The cell membrane, also known as the plasma membrane, is a thin, flexible barrier that surrounds the…
Q: Clonal amplification of DNA using microbiological organism faces challenges associated with (check…
A: A solid phase amplification of DNA fragments which helps in development of strong detectable signal…
Q: What codon results in a release factor entering the ribosome? 5' M GPPP-…
A: Translation is a process of formation of protein from mRNA. This process takes place in the…
Q: Determine the % inaccuracy by calculating the percent error of the micropipette at the set volume of…
A: In order to solve the issue, real weight measurements must be compared to the predicted volume using…
Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…
A: This question is about interpreting a scatter plot with a regression line from an experiment that…
Q: Tay-Sachs disease causes lysosomes to rupture. How would this affect the cell? Check all that apply.…
A: The nervous system is the main organ affected by Tay-Sachs disease, a hereditary condition. It is…
Q: 15 These are the weakest bonds of all and are sensitive to pH as well as changes in temperature. a.…
A: There are different types of bonds or biological interactions found in living systems. These bonds…
Q: A lima bean contains a plant embryo that is capable of becoming a mature plant with roots, a stem,…
A: The embryo is a diploid structure formed from the fusion of haploid female and male gametes. The…
Q: external lactose 0000 cell membrane RNA polymerase promoter The role of lac permease is to: lactose…
A: In bacteria, the genes that encode the enzymes of a metabolic pathway are usually clustered together…
Q: Analyze the following pedigree and determine the mode of inheritance. Assume that the traits being…
A: The correct answer is option D. Sex-linked recessive.
Q: 6 = W - 1 A 2 C ♦ ( ◆ ♦ N/A (> ◆ ◆
A: In a complementation chart a group will contain similar mutations that failed to compliment one…
Q: 2. How many hydrogen bonds can pyridoxal phosphate (shown below) donate to the surrounding water?…
A: A crucial coenzyme generated from vitamin B6 called pyridoxal phosphate (PLP) functions as a…
Q: Telomeres are at the end of linear chromosomes, and have a characteristic repeat sequence (5…
A: Telomeres are the repetitive nucleotide sequences present at the bottom of the chromosomes.These…
Q: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…
A: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…
Q: What is the size in µm of a cell that is 135mm wide in my photo? The scale bar in the photo is…
A: A microscope is a scientific instrument that allows us to see objects that are too small to be seen…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Figure 37.5 Heat shock proteins (HSP) are so named because they help refold misfolded proteins. In response to increased temperature (a “heat shock"), heat shock proteins are activated by release from the NR/HSP complex. At the same time, transcription of HSP genes is activated. Why do you think the cell responds to a heat shock by increasing the activity of proteins that help refold misfolded proteins?RAS is a signal transducer that acts as a switch for turning on cell division. Drag the descriptions below to their proper places on the figure to show the sequence of events. When growth factor binds to the receptor, the intracellular domain activates RAS by facilitating exchange of GDP for GTP. When no growth factor is bound to the extracellular receptor, RAS is bound to GDP and is inactive. RAS activates the first of three sequential kinase proteins termed the MAP kinase cascade. Cell proliferation proceeds as the machinery for cell division is set in motion. The end result of the MAP kinase cascade is activation of a transcription factor. Receptor 1 Ras GDP 2 4 5 Growth factor Ras GTPPut the following steps for the outline of the growth factor signaling pathway in order: Map Kinase Kinase is Phosphorylated Proteins involved in gene transcription are activated Growth factor binds to its receptor in the cytoplasmic membrane Receptor recruits adaptor protein and GEF Autophosphorylation of tyrosine residues on the receptor Structural change of the receptor activates Tyrosine Kinase Map Kinase Kinase Kinase is phosphorylated Ras, a small GTPase, is activated by the exchange of GTP for GDP Map Kinase is Phosphorylated Map Kinase enters the nucleus
- The epidermal growth factor receptor (EGFR) activates a complex signaling network to increase expression of several genes and promote cell proliferation as shown in the figure below. EGF Active EGFR Inactive EGFR Inactive EGFR P- EP Inactive Ras-GDP Ras-GTP Active Raf -P NUCLEUS МЕК-F МАРК-Р Active МАРК-P C-myc gene transcribed CYTOPLASM Cell proliferation Which of the following scenarios would result in decreased expression of the c-myc gene? Select all that apply A homozygous mutation of the EGFR gene resulting in a deletion of the ligand binding domain A homozygous mutation of the ras gene so that Ras protein was not able to exchange GDP for GTP A homozygous mutation of the ras gene so that Ras protein was not able to hydrolyze GTP for GDP A homozygous mutation of the MAPK gene so that MAPK protein was always in a phosphorylated stateCytokine receptors and tyrosine kinase receptors are similar in all of the following ways EXCEPT one. Which one is the exception? O They are both down-regulated by lysosomal degradation They both involve receptor exoplasmic domain dimerization They both result in an effector protein entering the nucleus O They both involve cytosolic domain phosphorylationWhen glucose is low and CAMP is present, CAMP's role is to O Activate catabolite activator protein (CAP) Activate RNA Polymerase Activate the repressor Deactivate the repressor
- Usmotic Which of the following is associated with intracellular nuclear receptors? O Transcription factors Signal transduction Transcription factors and signal transduction O O None of the above Back Next Clear formThe epidermal growth factor receptor (EGFR) activates a complex signaling network to increase expression of several genes and promote cell proliferation as shown in the figure below. EGF Active EGFR Inactive EGFR P- Inactive EGFR Inactive Ras-GDR Ras-GTP Active Raf -P МЕК- Р NUCLEUS МАРК-Р Active МАРК-Р C-myc gene transcribed CYTOPLASM Cell proliferation Which of the following scenarios would result in increased expression of the c-myc gene? Select all that apply. A homozygous mutation of the EGFR gene resulting in a deletion of the ligand binding domain A homozygous mutation of the ras gene so that Ras protein was not able to exchange GDP for GTP A homozygous mutation of the MAPK gene so that MAPK protein was always in a phosphorylated state A homozygous mutation of the ras gene so that Ras protein was not able to hydrolyze GTP for GDPGenistein is a compound found in soybeans that is known to increase the expression of a protein called Bax in certain breast cancer cells. Outside of Cell Toxins TNF DNA Damage Tradd TraF2 p53 Fadd Bax Caspases Bd-2 IKB NF-KB Apoptosis Inside of Cell Based on the above diagram, would you expect ingestion of soybeans to promote, suppress or have no effect on the progression of breast cancer cells. Suppress progression of breast cancer cells Have no effect on progression of breast cancer cells Promote progression of breast cancer cells TNFR
- What is the main benefit of cell signaling over long distances (ex: signaling via hormone secretion into the bloodstream)?Nucleation of straight, single line microfilaments is mediated by which of the following? Rho GTPase and Formin Rho GTPase and Arp 2/3 Cdc42 GTPase and Arp2/3 OCdc42 GTPase and Formin 14 < PreviousWhich of the following small GTP-binding proteins does NOT play a role in cell migration during chemotaxis? O Cap Z Rho Cdc42 O All of the listed GTPases play a role in cell migration O Rac ◆ Previous