Give typed full explanation How many chromosomes are shown in this picture?XO 1234O 5↑

A chromosome is a long, thread-like structure found in the nucleus of a cell. It carries genetic…

Answered: How many chromosomes are shown in this…

Science

Biology

How many chromosomes are shown in this picture? O 1 1234 O 5 ↑

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: Don't use chatgpt

A: To provide a more accurate answer, I would need additional information about the context of the…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: How can human stem cells be used to repair adult CNS dysfunctions? Please, I really appreciate the…

A: The nervous system disorders include cancer, congenital diseases, and neurodegenerative diseases.…

Q: red vs. white fiber

A: Red fiber- This type of fiber is also called the slow-twitch fiber and they store a high amount of…

Q: The answer here is incorrect. Can you rework it?

A: When the amount of stored fats in the body increases, it can affect the expression of various…

Q: How would pyrimidine dimers from the sun effect replication of this gene sequence?…

A: Pyrimidine dimers are the dimers formed between two pyrimidine molecules. Usually it forms between…

Q: Considering the time limit what should be opened first

A: Effectiveness and task prioritization are basic within the planning of an urgent surgical strategy,…

Q: Explain the RAAS mechanism. brief

A: Introduction: The cells, tissues, organs, and organ system are interlinked and live together in a…

Q: 9. Compare and contrast the two major types of neuronal pathways. Give an example of each.

A: The fundamental units of the brain and spinal cord is called neurons. It is also called nerve cells.…

Q: . What would be the consequence of an inactivating mutation in the HO gene in an a cell? [Select]

A: Inactivating mutation This mutation is also called as loss of function mutation. The product of this…

Q: What is the enhancer element? Select an answer and submit. For keyboard navigation, use the up/down…

A: In genetics, an enhancer is a small piece of DNA (50–1500 bp) that can be linked by proteins…

Q: Cell Form Function a. Spinal cord i. White matter ii. Gray matter b. Cerebellum i. Purkinje cells…

A: The spinal cord is a long tubular structure composed of nervous tissue extending from the medulla…

Q: Can someone please explain in detail how the Outer Membrane Proteins (OMP) system works?

A: The outer membrane of gram-negative bacteria contains a variety of proteins called outer membrane…

Q: act as signals between the components of the feedback loop.

A: Introduction A biological phenomenon known as a feedback loop occurs when a system's output either…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: tatus: * Question Completion Which letter in the figure represents phlanges? O A. A O B. B OC.C O…

A: The letter D depicting the body part is the phalanges. Phalanges are the bones that constitute the…

Q: Songbirds sing using a type of muscle fiber called super fast-twitch muscles. These super…

A: Muscle contraction and relaxation are regulated by the levels of calcium ions in the sarcoplasm…

Q: _cells stimulate both arms of the immune response (one arm is self and the other arm is foreign)

A: According to guideliness we have to answer the first question only so please kindly post the 2nd…

Q: The cytoplasmic granule of RNA and protein that reads the message in mRNA is a/an____________ .

A: In cells, different parts have specific jobs in making and controlling proteins. One important part…

Q: Required information Watch the animation and answer the question(s) that follow(s). -0.00/5:30…

A: The cells of nervous system other than neurons which are incapable of generating and transmitting…

Q: "A" refers to the OA. O A. pupil. O B. iris. O C. lens. O D. retina. OE. none of the above.

A: Our eyes are sensory organs for vision. They are help in perception of colour. Human beings has two…

Q: dentify the following structures, please label your answers with the corresponding number and be…

A: Question 72) Reissner's membrane 73) Tectorial membrane 74) Outer hair cells

Q: In protein synthesis, DNA transcription records the genetic message, while ribosomal ______________…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: What are the key differences between rough endoplasmic reticulum and smooth endoplasmic reticulum.…

A: The cell is the structural and functional unit of an organism that perform all the activities. The…

Q: Identify any 10 structures. Select five and explain the function.

A: The histological and operational unit of the kidney is the nephron. Each kidney contains about 1.3…

Q: Chapter 5 Improving Flexibility The following are the videos you will need to watch for Chapter 5.…

A: The video is all about stretching and knowledge of muscles. This gives a message that before…

Q: 8. Define a reflex. Name the five components of a reflex arc, and explain its operation.

A: Reflex action controls a number of body activities, it gives response to harmful stimulus very…

Q: What process is being depicted here? 3000 ÷

A: Protein synthesis stands as a pivotal process within our bodies, comprising two fundamental steps:…

Q: Neuron explanation

A: The coordination and balance in the body is mediated by the a network of cells that helps in…

Q: 37

A: Mitosis is a process where a single cell divides into two daughter cells.

Q: How many coding professionals are needed in a 60 bed hospital?

A: Medical coding professional is important to provide code for the various procedures that patient has…

Q: What do you think about integrated healthcare systems? Do you think healthcare organizations…

A: An integrated healthcare system, also known as an integrated delivery system refers to an…

Q: 2. Describe the structure of neurons and the function of their components. Describe the location,…

A: The functional unit of nervous system is called neurons. The size varies from 4 to 100 microns. The…

Q: _____________________ is the capacity of structurallydifferent components of a system to perform the…

A: The body of multi-cellular organisms consists of several organs which work systematically to govern…

Q: Report the effect of lowering extracellular glucose levels on each molecule or enzyme shown below.…

A: A. Phosphofructokinase 2 is deactivated when the extracellular glucose level is lowered. B.…

Q: A diploid cell is shown below. The cell has three pairs of chromosomes (2n = 6). Which image below…

A: Mitosis is an equational division which is responsible for producing the genetically identical…

Q: Question 26 SHORT ANSVWER (recall) What is the SIZE of an average gene? (give a range, in bp or kb)…

A: The nucleus of a cell contains the nucleic acids which are responsible for the passing down of…

Q: Which of the following statement is true? Answers A- D If just one of the essential amino acid is…

A: There are three types of amino acids: Essential amino acids Nonessential amino acids Conditional…

Q: 1. Define each term listed as the Nursing Diagnosis Qualifier (NDQ). 2. Provide three (3) Nursing…

A: As a nurse, understanding Nursing Diagnosis Qualifiers (NDQ) and their associated Nursing Diagnosis…

Q: hertability refers to

A: Genetics is the branch of Biology dealing with the study of genes including their structure,…

Q: Please answer fast Short explanation needed. Elaborate/discuss the metabolic pathways by which…

A: Is mitochondria is the power house of the cell ATP is the currency ATP stands for adenosine tri…

Question

Give typed full explanation

How many chromosomes are shown in this picture?
X
O 1
2
3
4
O 5
↑

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: What is a chromosome?

VIEW

Step 2: Answer and explanation

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

No need to explain just type the correct answer.
___________________ stabilize the structure of DNA and proteins.
Answer NUMBERS 4,8,10 (THEY ARE THREE QUESTIONS). Thank you
Hi expert please answer both its super easy for you
Hello, I hope you're doing great! I need help with these worksheets. I need to know the function and the cell form(columnar, Cuboidal, and Squamous, and where the nucleus is located(in the center or the edge of the cell). PLEASE NOTE:- I sent this question before, and it says that it is a graded answer, it is not a graded question. I was given this question to help me understand what kind of things might be in my exam Thank you!
answer choices in grey are for selected box
ANSWER BRIEFLY BUT COMPLETE. ANSWERS MUST BE ORIGINAL AND NOT JUST COPIED ON THE INTERNET. I WILL UPVOTE IF YOU FOLLOW MY INSTRUCTIONS. THANK YOU
You are a brilliant (but evil) biochemist who is developing a toxin that can be used to paralyze skeletal muscle. Using your knowledge of the sequence of cellular/molecular events that cause a muscle contraction, identify two parts of the process that could be disrupted to cause paralysis, and explain the specific effect of each disruption on contraction. please help
The function of proteins such as casein and zein is _____________
Please answer all for the UPVOTE. Write TRUE if the statement is correct, but if false, change the underlined word or group of words to make the whole statement true. a. Cell is a membrane-bounded unit that contains RNA and cytoplasm. b. Membranes are exquisitely sensitive to chemical messages, detecting them with receptor proteins on their surfaces that act as antennae. c. The cytoplasm of a cell contains ions and molecules, such as sugars and amino acids, dissolved in water.
Don't copy answer please
Water aerobics is a good exercise for cardiac patients because the water pressure compresses the legs, similar to the way that compression stockings do. In theory, the compression will increase cardiac output without a change in heart rate. Why would compressing the legs increase cardiac output? (3 sentences max) Edit View Insert Format Tools Table 12pt Paragraph v