A nontemplate strand of bacterial DNA has the base sequence 5'-ATGATACTAAGGCCC-3' Determine the amino acids that will be encoded by this sequence. Add the amino acids from left to right in the order the amino acids will be translated.
Q: Which of the following statements is true about consensus sequences in DNA? Group of answer choices…
A: Short nucleotide segments which recur often in conserved sequences are known as consensus sequences.…
Q: As a student of genetics, you become interested in the phenotype of feathered legs in Black Langshan…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: What is the sequence of events in a typical eukaryotic cell cycle? O G1 to G2 to S to mitosis to…
A: Cell cycle refers to the ordered series of events that lead to the cell division and the production…
Q: Let's say that you have been tasked, at a bioengineering firm, to design a synthetic biological…
A: A synthetic, artificial, or minimum cell is a particle that has been designed to replicate one or…
Q: Species A, B, and C are related according to the phylogeny below (A,(B,C)). Species A and C…
A: Phylogeny is the evolutionary history and relationships of a group of organisms, often depicted in…
Q: Percentage of Beans(Pinto and Pea) 70 60 50 9 10 0 Prey Camouflage % of beans caught by Prey in…
A: Hypotheses are statements of proposed explanations of a phenomenon based on its observation.…
Q: Here is the question: Question Intro to Neuroscience Question: Students are celebrating the end of…
A: Your answer seems quite coorect.
Q: What would happen to the base pairing of DNA if we removed the van der Waals dispersion forces?…
A: One may visualize the DNA structure as a spiraling ladder. The structure seen in the above image is…
Q: Explain the concepts of specificity and associativity in hippocampal LTP in 2-4 sentences.
A: Synapses are the junctions between neurons where electrical signals are transmitted. They are…
Q: Briefly explain why planting trees would mitigate the effects of global warming.
A: Planting trees and engaging in reforestation efforts play a crucial role in mitigating the effects…
Q: Question: Define transcription and
A: Transcription is considered as first step in gene expression. This process takes place in the…
Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…
A: The AUC and AUA codons in mRNA both specify isoleucine. This feauture of the genetic code explains…
Q: What is the mechanism of myogenic autoregulation? Where does this take place? How will this affect…
A: The system which helps to pump blood from heart to lungs to get oxygen is known as cardiovascular…
Q: Discuss the All or None Law of Muscle contraction.
A: The tightening, decreasing, or lengthening of muscles during an activity is known as muscular…
Q: v a two-state model of a muscle sarcomere - representing relaxed and contracted forms. are your…
A: Muscle fibre consists of A and I bands. These bands are formed due to the regular parallel and…
Q: Using the operation mechanism of GLUT1 and its types of transport proteins, explained how glucose is…
A: Glucose, a crucial energy source for cells, needs to be transported across the cell membrane to be…
Q: What type of mutation in an operon is most likely to to affect the synthesis of more than one…
A: Any abrupt changes that occur during DNA replication that changes the sequences of nucleotides is…
Q: examine whether the statement "Hydrochloric acid is produced in the esophagus", is true or false.
A: Esophagus is also called the gullet or oesophagus. It is an organ through which food passes from the…
Q: Two species have the same initial population size of 48.00, as well as rates of b = 0.83 and d =…
A: The question discusses the fascinating contrast between seasonal reproduction and continuous…
Q: True or False: A decrease of plasma pH along with a decrease of plasma [CO2] is an indicator of…
A: Metabolic acidosis is a medical condition characterized by an excess of acid in the body's fluids,…
Q: In multicelllular organisms, cells are held together in a few different ways.what are three ways…
A: In the case of multicellular organisms the adjacent cells are held together by different types of…
Q: Calculate the transpiration rate for the grape leaf above with a leaf surface area of 18 cm2. Air…
A: Transpirtation is the process by which plants lose their water. By this process they remove excess…
Q: search this information: 1. Toxicities: negative things it can cause 2. Contraindications: when not…
A: In this discussion, we'll dig into the properties of Bai Zhi, also known as Angelica root, in the…
Q: (a) 0.25- Turbidity (AU) 0.20- 0.15- 0.10- 0.05- 0.00+ 0 Wt Mutant 1 Mutant 2 Mutant 3 Mutant 4 2 4…
A: Protein aggregation is a major challenge in the development and production of biopharmaceutical…
Q: Chromosome Chromosome A has genes ABCD-EFGHIJ B has genes 1234-56789.
A: The Correct Option is B Unbalanced nonreciprocal translocation
Q: Rho, Rac, and Cdc42 are three different GTPases that regulate cytoskeletal dynamics. We've…
A: Introduction and overview GTPases are a large family of proteins that function as molecular…
Q: Part A: Animal cells do not have chloroplasts A. True B, False Animal cells carry out cellular…
A: The mechanism via which biological fuels undergo oxidation in the presence of an inorganic electron…
Q: Predict the outcome of the following hypothetical experiments and be sure to explain and be rational…
A: Three fictitious studies are given, all of which include medication treatments or molecular changes…
Q: Part A: Plant cells also have mitochondria A. True B. False Do plants carry out cellular…
A: NOTE:“Since you have asked multiple questions, we will answer the first question for you. If you…
Q: Q5.3. Someone has handed you the following graph of changes in the frequency of one allele in a…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: cording to this tree, taxa capable of photosynthesis form what kind of phylogenetic up?…
A: The image shows the phylogenetic relationship between different taxons. The relationship is based on…
Q: b) Name 2 vitamins that are essential but not necessary in the diet.
A: The body requires nutrients for building blocks, energy production, and process regulation. Based on…
Q: Q: Which of the following statements ACCURATELY describe spinal cord organization. α-motor…
A: The spinal cord is a cylindrical structure present between the body and the brain that extends from…
Q: Use Verbal description of results from graph and then Interpret the graph for Speacialization…
A: The graph on display portrays the average proportion of consumed food items by foragers within a…
Q: Q1. Predict the effects (on translation of coat gene and replicase gene) of the following mutations…
A: Bacteriophage R17 is a small RNA virus that infects Escherichia coli bacteria. Its genome encodes…
Q: e) Which disaccharide is the most important part of the natural human energy supply? (2%) Lactose,…
A: Introduction:Lactose, a disaccharide composed of glucose and galactose molecules, holds a paramount…
Q: You grow plants under two watering treatments: high water and low water. You examine photosynthetic…
A: In the provided image, the dashed line denoted as B corresponds to the "b) low watering treatment".…
Q: To which CLASS does the animal in the images below belong (both images are same subclass)? & 83
A: A class is a taxonomic rank (also known as a taxon) that refers to a group of creatures with similar…
Q: What key traits distinguish each group from the other listed in the comparison? A) All land plants…
A: Plants are considered to be living things. It shows how it has grown on Earth. It has several…
Q: What evaluation method for healthcare quality improvement initiative at 3, 6, and 12 months could be…
A: The initial phase in assessing the efficacy of a quality improvement initiative necessitates the…
Q: 1a. Describe three types of genetic variants and briefly describe the mechanisms that generate them…
A: In the field of genetics, the concept of linkage disequilibrium (LD) plays a pivotal role in…
Q: Where on this cladogram would the trait of bipedalism be placed?
A: An creature that uses its two back limbs or legs to move about on land is said to be bipedal. An…
Q: 8. Consider a relaxed, covalently-closed circular DNA plasmid that has 2080 base pairs with Wr = 0.…
A: The scenario introduces an intercalator molecule. Intercalators are molecules that may insert…
Q: When we perceive a stressful event or situation, our brain enhances our initial stress response by…
A: When we perceive a stressful event or situation, our brain enhances our initial stress response by…
Q: me structural component of the peripheral nervous system with their function.
A: Peripheral nervous system includes all nervous tissues found outside the central nervous system. It…
Q: Where on this cladogram would the trait of “modern human height” go?
A: The cladogram shows the evolutionary relationships between hominin species. Modern human height is a…
Q: The data table shows the number of sea turtle eggs that emerged from closely observed nests on a…
A: The provided dataset pertains to the emergence of sea turtle eggs from closely monitored nests along…
Q: Draw on one graph, with N2 on the y-axis and N1 on the x-axis, the isoclines for the two competitors…
A: This question is asking for a graphical representation of the competition between two species, with…
Q: summarise the Concept of optimal conditions/ denaturing enzyme
A: The concept of optimal conditions for denaturing enzymes refers to the specific environmental…
Q: Which area contains axons of the vestibulospinal tract?
A: The area that contains the axons of the vestibulospinal tract in the image you sent is B.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- (ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
- 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-TyrGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.