Question 9 ◄ Listen If a DNA sequence changes from 5' ATA 3' to 5' TTA 3' the result will be a UUU Phe UCU UAU UGU Tyr Cys UUC UCC UAC UGC Ser UUA UUG & } UCA UAA Leu UCG UAG} Stop UGA Stop UGG Trp CUU CCU CAU CGU CUC CCC CAC His CGC Leu Pro Arg CUA CCA CAA CGA CUG CCG CAG Gln CGG AUU ACU AAU AGU AUC lle ACC AAC Asn Ser AGC Thr AUA ACA AAA AUG Met ACG AAG } Lys AGA AGG }} Arg GUU GCU GAU GGU Asp GUC GCC GAC GGC Val Ala Gly GUA GCA GAA GGA Glu GUG GCG GAG GGG a) Missense mutation b) Silent subsitution c) Frameshit d) Nonsense mutation

Question 9 ◄ Listen If a DNA sequence changes from 5' ATA 3' to 5' TTA 3' the result will be a UUU Phe UCU UAU UGU Tyr Cys UUC UCC UAC UGC Ser UUA UUG & } UCA UAA Leu UCG UAG} Stop UGA Stop UGG Trp CUU CCU CAU CGU CUC CCC CAC His CGC Leu Pro Arg CUA CCA CAA CGA CUG CCG CAG Gln CGG AUU ACU AAU AGU AUC lle ACC AAC Asn Ser AGC Thr AUA ACA AAA AUG Met ACG AAG } Lys AGA AGG }} Arg GUU GCU GAU GGU Asp GUC GCC GAC GGC Val Ala Gly GUA GCA GAA GGA Glu GUG GCG GAG GGG a) Missense mutation b) Silent subsitution c) Frameshit d) Nonsense mutation

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCATGCGAT 5' Start site Short Answer
Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start site
QUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.
Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this DNA sequence: TGCAGACT *record your answer with no spaces, dashes, or other characters
QUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Question 17 What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3 A 5'-UAGUGACAGUUGCGAU-3' B 5-TAGCGTTGACAGTGATA-3 5'-ATCACTGTCAACGCTA-3 D 5'-TAGTGACAGTTGCGAT-3'
Question 17 What is the nucleotide sequence of the DNA strand that is complementary to 5-АTCGCAACTGTCAСТА-3 A 5-UAGUGACAGUUGCGAU-3' B 5'-TAGCGTTGACAGTGATA-3" с) 5-АТCАСTGTCААCGCTA-3 D 5'-TAGTGACAGTTGCGAT-3'
Question 6 There is an addition of Adenine in the MRNA sequence specifically at AUG codon. missense mutation O nonsense mutation O silent mutation O frameshift mutation
Question 25 If one DNA segment has the following base composition, 5-CAGTTAGTCA-3', which of the following sequences is complementary? A 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5' 3-TGACTAAСTG-5 D 5-TGACTAACTG-3'
QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
Question 14 Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a synthetic RNA? RNA con 2nd poston UCAG powton pton Tyr Cys Tyr stop stop stop His His Gin Gln Phe Phe Leu Ser Ser Ser Cys A. Leu Leu Leu C Leu Leu Ser Pro Pro Pro Pro Trp G Аrg Arg C Arg A Arg lle lle lle Met Thr Thr Thr Thr Ser Asn Asn Lys Lys A Ser C. Arg A. Arg Gly Gly Glý Val G Val Val Ala Ala Ala Ala Asp Asp Glu Glu Val Gly G. Amino Acids Thearne w ve A) poly-W в) poly-G (c) poly-V D poly-Y
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATT CA CGTGGATGGTCAGTA... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCTACCGATCAT... 5' Start site