2) Create an MRNA strand based on the given DNA template strand:TACTTCCTATTITCTTGTCA CCGCACT3) Using the mRNA codon chart, determine the amino acid sequence for the MRNAsequence determined in question 3.4) Consider the following double-stranded DNA molecule:Complementary Strand: ATGTGTAGTGCGAGTTGATemplate Strand:TACACATCACGCTCAACTa) What would be the amino acid sequence coded for by the template strand of theDNA molecule above?

Name: 2) Create an MRNA strand based on the given DNA template strand:TACTT
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 2) Create an MRNA strand based on the given DNA template strand:TACTTCCTATTITCTTGTCA CCGCACT3) Using the mRNA codon chart, determine the amino acid sequence for the MRNAsequence determined in question 3.4) Consider the following double-stranded DNA

The process of synthesis of RNA with the help of DNA is called transcription and the process of…

Science

Biology

Create an mRNA strand based on the given DNA template strand: TACTTCCTATTTTCTTGTCA CCGCACT Using the MRNA codon chart, determine the amino acid sequence for the mRNA sequence determined in question 3. Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?

Create an mRNA strand based on the given DNA template strand: TACTTCCTATTTTCTTGTCA CCGCACT Using the MRNA codon chart, determine the amino acid sequence for the mRNA sequence determined in question 3. Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
1) What DNA base sequence is complementary to the following DNA sequence?TAGCGTGCATGGTGCTTAAC2) What RNA base sequence is complementary to the following RNA sequence?UAAUAGCUUGCUGAU
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the complementary DNA sequence that would form the double helix: 2. Write the sequence of the mRNA transcript that would be produced from transcription (use the original sequence, not the complement you just wrote): 3. Now, using the mRNA transcript and the table, write the amino acid strand produced from translation:
Transcribe the following DNA sequence. Then translate the resulting mRNA transcript. GGACTACGTTCAAAAGCCATGGATTCGGTA Transcription: Translation: What would be the result of the following mutations in the DNA sequence above? How would the polypeptide change? How would you characterize this mutation? (Nucleotides are numbered from left to right.) a) nucleotide number 16 changes from a G to an A b) nucleotide number 12 changes from an A to a T c) nucleotide number 8 changes from a G to an A d) an insertion of a C between nucleotides 14 and 15.