5. You sequence the following piece of DNA from E. coli: CGT TAC AAT GAA CCT ATA TGA ACT ATT GCC TTC GTA TCA CAT GCG GCA GCA ATG TTA CTT GGA TAT ACT TGA TAA CGG AAG CAT AGT GTA CGC CGT There are two possible coding sequences in the region shown above. Underline them, and below write out the resultant mRNA sequence and amino acid sequence derived from these "genes". Also indicate the polarity of the two strands of DNA shown above.

5. You sequence the following piece of DNA from E. coli: CGT TAC AAT GAA CCT ATA TGA ACT ATT GCC TTC GTA TCA CAT GCG GCA GCA ATG TTA CTT GGA TAT ACT TGA TAA CGG AAG CAT AGT GTA CGC CGT There are two possible coding sequences in the region shown above. Underline them, and below write out the resultant mRNA sequence and amino acid sequence derived from these "genes". Also indicate the polarity of the two strands of DNA shown above.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 10RQ: If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following...

See similar textbooks

Similar questions

Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
2. Here is the detailed view of the MCS of the PUC19 plasmid: Sma I KpnI SbfI PstI SacI XbaI ECORI BamHI Sall SphI HindIII agt GAATTCGAGCTCGGTACCCGGGGA TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGcgtaatcatggtcat 400 410 420 430 440 450 460 ...S N S SP VR PDEL TS R CAH LS P T IM T M lacZa translational start Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA that would be cut out. Show both strands. For reference, here are the recognition sequences: 5' G|GAT СС 3' 3' С СТАG|G 5' recognition sequence for BamH I 5' G GTAC|C 3' 3' cl CATG G 5' recognition sequence for Kpn I Figure 26: recognition sequences for BamH I and Kpn I
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St
2. a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 3'тTGCATССGAAАCGTACGATCGATCGGCCGACTТАТТАСGАТСGGACTAфTGCGTCсTAGC5'... ...5'AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3'... (i) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5' and 3' ends from left to right of the RNA strand. (ii) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i).
40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter
8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
3 E D C The arrow in the diagram below indicates the direction of movement of the replication fork. 5' S R F Q Search Which letter indicates a strand that is synthesized discontinuously? OA Ов ос V A F5 T C G B F6 T 6 Replication B LDL Y F7 H & 7 WALLS U N F8 * 00 99+ 8 J₁ F9 kirimmi MO 35 Alt מם E K 2 F10 L P < F12 10:05 AM 4/8/2023 Ctrl 10 B
F3 3 E Which process is illustrated in the diagram? D VW/VVVVVVVVX C Replication Transcription RNA processing Translation 5' Gene expression F4 Q Search R F F5 % 5 V T F6 G 6 O Y F7 H & 7 U B N F8 99+ F9 * 8 8 J 1 1 5 3' N ( 9 9 MO F10 Alt K 2 O 6 P L 3 A F12 ? Ctrl